Para Mí Son Enigmas

Un debate es una lucha que fortalece a todos los que participan.

¿CÓMO HACER UNA DEMOCRACIA REPRESENTATIVA? (PARTE ii)

Lo primero, acabar con el sistema proporcional en el que unos cuantos partidos políticos se reparten el poder en todo el país según la cuota que les dan los votantes. Esto hay que sustituirlo por una Asamblea, en la que se reúnan diputados, elegidos por mayoría en cada distrito electoral, independientemente de qué partido sean o de que no sean de ningún partido, y que defiendan los intereses de su propio distrito, juntos tengan el poder de hacer las leyes. De este modo, esos diputados independientes y sin necesidad de obedecer a nadie (al presidente de su partido, por ejemplo, como sucede ahora con todos los diputados, que tienen que obedecer ‘al partido’ o por lo menos lo hacen para mantenerse en ese puesto) como representantes directos de la sociedad que los ha elegido por mayoría en cada distrito (idealmente, cada distrito tendría unas 100.000 personas, pues más allá de eso es difícil una democracia directa y hay que dar paso a la elección de representantes) ellos hacen las leyes, y son el poder legislativo. En una elección independiente, se elegiría al presidente de la República, que sería el poder ejecutivo, pero que no tiene ningún poder para hacer las leyes ni, por supuesto, para juzgarlas. El Presidente no representa ni debe hacerlo a la sociedad, ni tiene capacidad decisoria, solamente simboliza el poder ejecutivo (equivalentes: la autoridad, el Estado). Es una manera de que poder ejecutivo y legislativo se escojan y sean independientes. A partir de ahí puede haber variaciones pero siempre partiendo de la base de que los poderes estén separados, y de que haya un órgano intermedio entre la sociedad civil y el Estado (el Presidente, el consejo de ministros, la Policía, la burocracia estatal…). Ese algo debe ser una Cámara de Representantes que tenga la capacidad de promulgar y crear nuevas leyes, aunque la posibilidad de proponer leyes puede venir tanto del Gobierno (ejecutivo) como del poder judicial o de la sociedad civil representada en esa Cámara.

Fijáos que el modelo de la República Constitucional no está de acuerdo con la partidocracia ni con la dictadura totalitaria (evidentemente) pero tampoco con el comunismo o el anarquismo, que pretenden la abolición del Estado. Tampoco lo está con la democracia directa al estilo de la ateniense, más que nada porque es imposible hacerla siendo más de 100.000 personas (y somos 7.000.000.000 en el planeta). Otro de sus fundamentos es que la verdad política equivale a libertad colectiva (verdad = libertad). Esto es algo que también me parece muy bueno, y es que lo que se haga realidad a nivel de lo político, es decir de lo público que concierne a tod@s, debe partir siempre de la continua y permanente libertad colectiva (o sea, libertad de decisión) de la sociedad civil (el conjunto de las personas individuales). La voluntad del partido que saca más votos en las urnas, sin control ninguno de su poder, al no partir de la libertad colectiva, tampoco debería convertirse en verdad política. De este modo, la gente que no está de acuerdo con un partido no tiene que joderse si otro ha sacado más votos. En realidad, para que eso no suceda hay que acabar con el sistema proporcional de listas (no importa que las listas sean cerradas o abiertas).

Pues todo esto y en realidad muchísimo más es lo que ayuda a comprender el libro ‘Teoría pura de la República’. Su autor explica y argumenta todo de forma muy clara aunque se expresa con un lenguaje culto, y te lleva a entender gracias a esa claridad muchos hechos históricos, la Revolución Francesa, la independencia de Estados Unidos, la historia reciente de España… Un libro con el que terminas lleno de claridades y no de confusiones.

Antonio García Trevijano es un personaje desconocido pero muy importante de nuestra historia. Hay muchísimos videos de él en la red, sus libros en cambio son mucho más difíciles de conseguir (actualmente, la Teoría pura de la República está descatalogado y yo lo he encontrado en una biblioteca pública). En este video habla sobre la partidocracia:

El primer paso que propone el MCRC es la ABSTENCIÓN ACTIVA, no acudir a las urnas en un sistema de elección oligárquico y fraudulento, sin representatividad de la sociedad civil en los elegidos.

En esta web podéis escuchar los programas de radio en los que da su opinión sobre los artículos de la prensa española y otros temas.

http://www.diariorc.com/

Finalmente aquí tenéis el blog el Movimiento que él dio inicio, el MCRC:

http://antoniogarciatrevijano.com/bienvenidoa-al-mcrc/

Anuncios

marzo 25, 2014 Posted by | Actualidad, Control de la sociedad, Revolución / Capitalismo | 79 comentarios

LA REPÚBLICA CONSTITUCIONAL, ¿POR QUÉ DEFENDERLA?

Acabo de terminarme otro de esos libros que por desgracia son bastante difíciles de encontrar fuera de internet, y os quiero hablar un poco sobre las importantes cosas que dice, aclara y sobretodo lo que propone. El libro no es otro que ‘Teoría Pura de la República’ escrito si no me equivoco en 2011 por Antonio García Trevijano. El libro es un chorro de agua fría para cualquiera que defendiendo el sistema político en el que vivimos, se atreva a leerlo. Un libro que recomiendo a cualquiera que piense que es democrático vivir en un estado de partidos, o partitocracia, en el cual la única posibilidad de elección por parte de la gente es la de elegir cada cuatro años entre un partido u otro, y que esto es mejor que nada y el opuesto directo de una dictadura totalitaria.

En realidad, estamos votando para ver a quién le concedemos un poder absoluto, porque el partido que saque más votos constituirá el Gobierno (poder ejecutivo) pero también tendrá la capacidad de hacer las leyes (legislativo) y de nombrar jueces afines a su partido (judicial). Nos encontramos en una situación que desconecta por completo a los gobernantes de la gente, ellos tienen todo el poder y la gente ninguno. Esto no puede recibir otro nombre que el de ‘oligarquía de partidos’, siendo en el caso español el rey tan solo un miembro más de la oligarquía, solo que hay que aguantarlo por huevos. La oligarquía se caracteriza por el uso de la demagogia, la propaganda y la corrupción, todo para mantenerse en el poder, que es el objetivo de los partidos políticos, y no lo hacen así porque sean mala gente (por supuesto que muchos lo son, solo que esa no es la causa) sino porque nadie controla su poder. En el caso de España, tenemos una Constitución que fue redactada por una serie de personas a las que nadie eligió, y que se instituyeron a si mismos como jefes de partidos políticos que son los que ahora votamos. Si nadie eligió a las personas que la redactaron, ¿creemos que la Constitución de 1978 es democrática? ¿Solo porque en su día, y poco tiempo tras la muerte de Franco, la opción de elegir ‘sí o no’ a dicha constitución?

Una de las cosas de las que aún tiene que desengañarse mucha gente es de que vivimos en libertad y en democracia, ya que much@s todavía confunden votar con elegir o sea, creen que si el pueblo va a votar entre una serie de oligarcas (no importa que sean de izquierdas, de derechas, comunistas o conservadores) eso significa que el pueblo tiene el poder. Tanto en el Parlamento Europeo como en los Estados de partidos de toda Europa, a nivel nacional, el poder lo ostentan una serie de partidos políticos según la cuota de poder que los votantes les conceden con sus papeles. La votación no es mas que un trámite administrativo en el que se da a optar por un día a la población civil entre un partido u otro, para que ese partido obtenga el poder absoluto, sobre 3 poderes que no están separados. En un sistema donde el partido que salga elegido por muy buena que sea su intención, no tendrá capacidad alguna, ya que estará separado del pueblo, de oponerse a los grandes poderes económicos (FMI, BCE, Reserva Federal, Banco Mundial, grandes corporaciones…). Su desconexion con el pueblo hacen quedar todas sus bonitas palabras en mera propaganda de campaña. ¿Que posibilidad tiene el pueblo de controlarles cuando acceden al Parlamento europeo o al Congreso de un país gracias a los votos obtenidos? ¡Ninguna!

Un poder sin posibilidad de ser controlado, junto a la farsa de las elecciones para que la gente ratifique el poder de unos pocos. No importa que partido salga elegido, si su poder no puede ser controlado, no es democrático. ¿Qué se podría hacer, cómo realizar de verdad un sistema representativo y democrático?

Lee la siguiente entrada.

[IMG]https://i1.wp.com/i57.tinypic.com/r0y0cg.jpg[/IMG]

marzo 22, 2014 Posted by | Actualidad, Control de la sociedad, Revolución / Capitalismo | 16 comentarios

ACERCA DEL GEN DE LA OBESIDAD.

Si veis la TV o la prensa puede que estos últimos días os hayáis cruzado con la noticia de que se ha encontrado un gen responsable de la obesidad, que hace que unas personas engorden más que otras aunque coman lo mismo. Quiero hacer unas reflexiones sobre este estudio y enlazarlo con otros en los que también se vincula un gen a la violencia (gen MAOA) o a la propensión a dormir más o menos (gen ‘despertador’) etc.  Se trata de un estudio realizado entre la Universidad de Chicago (EEUU) y el Centro Andaluz en Biología del Desarrollo de Sevilla y publicado el 12 de marzo de 2014 en la famosa revista ‘Nature’ (lo podéis ver abajo, aunque solo la introducción del estudio).

http://www.nature.com/nature/journal/vaop/ncurrent/full/nature13138.html

http://www.lanacion.com.py/articulo/159412–identificaron-al-irx3-o-el-gen-principal-del-engorde-humano.html

Lo que estos científicos han descubierto concretamente son dos cosas:

– Primero, que aquellas personas con una variante específica del gen FTO tienen, como media, un peso superior. Esto lo podéis ver en esta parte del artículo en Wikipedia:

‘A study of 38,759 Europeans for variants of FTO identified an obesity risk allele. In particular, carriers of one copy of the allele weighed on average 1.2 kilograms (2.6 lb) more than people with no copies. Carriers of two copies (16% of the subjects) weighed 3 kilograms (6.6 lb) more and had a 1.67-fold higher rate of obesity than those with no copies. ‘

[Un estudio de 38.759 europeos sobre variantes del gen FTO identificó un alelo de riesgo para obesidad. En concreto, los que tienen una copia del alelo pesaban como media 1’2 Kilogramos más que aquellos que no tienen ninguna copia. Los que tienen dos copias (que eran el 16% de los sujetos) pesaban 3 Kilogramos más y tenían una tasa de obesidad 1’67 veces superior a aquellos con cero copias.]

Voy a intentar aclarar lo que significa eso.

– Variantes del gen FTO: Un gen es una secuencia de ADN ubicada en los cromosomas. Dentro de la población humana, un mismo gen puede tener variaciones de secuencia respecto a otras personas (esto se llama polimorfismo). El ADN está compuesto por cadenas de cuatro ‘nucleótidos’ que se identifican con estas letras: A, G, C y T. Así, forman largas cadenas o secuencias de estas ‘letras’, por ejemplo:

AGGTCCGATTTAGCTGGATCGGATCGGATGCTGAGTCGATCG…

Pero los ‘genes’ que son solo aquellas partes del ADN encargadas de guardar información para fabricar proteínas, están divididos en varias partes que se llaman ‘intrones’ y ‘exones’.

[IMG]https://i2.wp.com/i60.tinypic.com/2hf8i8g.png[/IMG]

Estas son partes que se pueden incorporar o no a las proteínas finales, y esto es importante para lo del gen de la obesidad, porque la variante del gen FTO que está ligada a obesidad es una que tiene 1 de las letras cambiadas en un intrón. Los intrones son secuencias intercaladas en los genes que solo se incorporan opcionalmente a las proteínas, en la imagen de arriba, bastante buena y simple, lo que se ve es cómo solamente los exones al final se cortan y vuelven a pegar en el ARN mensajero (que luego irá a fabricar una proteína). Los intrones se eliminan y no se usan, en este caso, para incorporarlos a la proteína.

FTO es el ADN que se utiliza para fabricar la proteína FTO. Explicar la función de esta enzima lo veo ya bastante complicado para lo que es esta entrada, pero bueno si queréis os lo explico en los comentarios. Hablemos del intrón relacionado con la obesidad, y esta es la segunda cosa que han descubierto los científicos de este estudio.

– Ese intrón del gen FTO, en realidad es una secuencia reguladora de OTRO gen diferente y muy alejado del gen FTO. Esta segundo gen se llama IRX3 (o iroquois 3). Resulta, que la variante del gen FTO ligada a obesidad, lo es porque hace que el gen IRX3 se exprese más. Según los investigadores, una mayor expresión de IRX3 hace que el cuerpo tienda a acumular más grasa y es un factor de riesgo para obesidad.

Tenemos pues dos genes, uno que influencia al otro desde la distancia.

Entonces, se puede sintetizar todo el descubrimiento científico en dos puntos:

1) Aquellas personas con una variante concreta del gen FTO pesan en promedio algo más que aquellas que no la tienen.

2) Los animales a los que se ha suprimido el gen IRX3 (ratones ‘knockout’ por ejemplo, o ratones con el gen silenciado por ARN de silenciamiento, todo esto hecho por los propios científicos en laboratorio) son más delgados a pesar de comer una dieta elevada en grasa.

La conclusión es que la propensión a engordar es mayor en unas personas que en otras según su genética. Y esto no está mal saberlo, pero para estos investigadores: ‘los genes controlados por IRX3 pueden ser dianas para nuevos fármacos que permitan reducir la obesidad’. Pero resulta que el gen IRX3 no está solamente ligado a la obesidad, sino que él mismo controla a muchos otros genes, implicados por ejemplo en el desarrollo, en el sistema nervioso, etc… Es lo que se llama un ‘gen homeótico’. Esto lo convierte en una diana más que peligrosa para fármacos que lo inactiven, podría tener serios efectos secundarios.

Además, decir y transmitir a la gente que se ha descubierto un gen que hace más fácil la obesidad y achacarle a ese gen la responsabilidad es caer en lo que se llama el ‘determinismo genético’. La manera de prevenir la obesidad no es inactivar un gen, sino decirle a la gente que no coma comida basura, que haga más ejercicio o vea menos la TV. La conclusión de que esto abre una vía para la creación de nuevos fármacos etc, es más que interesada, imaginemos que se crean estos fármacos, con graves efectos secundarios, y que la gente los toma para adelgazar. ¡Esto significa, adaptar químicamente a la gente a un estilo de vida insalubre, sedentario y de mala alimentación! ¿Tal vez estas sean las intenciones del NIH (Instituto Nacional de Salud) de Estados Unidos, que es quien ha financiado esta investigación?

Es interesada por lo siguiente:

1) El hecho de que las personas con un determinado gen pesen un poco más en promedio que las que no tienen esa variante del gen, no significa que si miramos a todas las personas obesas, y las comparamos con las más delgadas, veamos este gen únicamente en las personas obesas, eso es falso. Si se hiciera eso, la conclusión sería que factores como la comida basura y el sedentarismo, tal vez los azúcares simples, están detrás de la obesidad. No habría correlación tan precisa entre gen y obesidad.

2) Mutar a unos animales para privarles de la actividad de un gen, y ver que son más delgados, no significa que tener la actividad del gen sea la que te haga obeso, como el hecho de tener manos no implica que las vayas a usar para apuñalar. Sin embargo, si se observa el nivel de apuñalamientos entre personas mancas y personas con manos, se verá un nivel superior en aquellas personas con manos. Realmente es lo mismo a escala molecular: es verdad que sin ese gen no podrías acumular la grasa, pero la presencia de una variante concreta del gen no te va a convertir en obeso, ¡eso dependerá del modo en que te alimentes, tu estilo de vida y tu estado de ánimos incluso!.

[IMG]https://i0.wp.com/i62.tinypic.com/wch5b4.jpg[/IMG]

Os muestro estudios con genes vinculados a otras cuestiones y donde se sacan conclusiones similares. En cuanto pueda haré unos comentarios sobre estos artículos.

http://www.abc.es/salud/noticias/20140313/abci-sueno-201403131319.html

http://www.pnas.org/content/106/7/2118.long

marzo 22, 2014 Posted by | Actualidad, Control de la sociedad, Salud humana y Nutrición, Transgénicos | 5 comentarios

UNO DE LOS ENIGMAS EN NUESTRO ADN: LAS SECUENCIAS Alu.

Buenas, quiero hablaros de un tema que he estado estudiando un poco estos días, y es sobre unas secuencias de ADN llamadas ‘secuencias Alu’ que tenemos repartidas por nuestros cromosomas (en nuestro ADN) y que son un paso clave de la evolución de los primates.

Si pretendo que me entendáis tengo que explicaros lo básico, pero intentaré hacerlo lo más corto posible. Veréis nuestro ADN se distribuye en cromosomas (concretamente, el ser humano tiene 46 y más propiamente, 23 pares ya que se encuentran ‘duplicados’ dentro de cada célula). A lo largo de esos cromosomas, solamente un 1,5% son los genes que codifican proteínas. El resto del ADN fue considerado por la mayoría de los biólogos, durante mucho tiempo como ‘ADN basura’ pero más adelante se descubrió que había secuencias fuera de los genes que intervienen en su regulación (es decir, controlan si unos genes expresan o no proteínas). El control de la expresión de las proteínas es necesario ya que en nuestro cuerpo una célula sanguínea, una neurona y una fibra muscular, son muy diferentes pese a compartir el mismo ADN, y se debe al control de las proteínas que están produciendo entre otras cosas.

Otra de las cosas que se descubrió en nuestro genoma (que es el ADN que llevan nuestras células) es que tiene un montón de secuencias que se repiten a lo largo y ancho del mismo. En el genoma humano, las secuencias ‘Alu’ son un tipo de ellas, ya que hay más de 1.500.000 (millón y medio) de copias de Alu a lo largo del ADN, ocupando un 10% del mismo. Pero antes, tenemos que hacer una diferencia. Hay dos tipos de regiones repetitivas en el ADN:

– Aquellas que se repiten ‘en tandem’, ahí están los llamados ‘microsatélites’ y ‘minisatélites’ que son cortas secuencias de ADN pero que se van repitiendo una detrás de otra sin separación entre si, puede haber cientos o miles de repeticiones.

– Aquellas que son muy abundantes, pero que están separadas entre si. Uno de los más frecuentes son los llamados RETROTRANSPOSONES. Estas son secuencias que pueden desplazarse por el genoma, copiándose a un ARN el cual a su vez será reconvertido en ADN y reincorporado al genoma en otro sitio. Así, pueden realizar copias de si mismos y expandirse. Existen 3 tipos:

  • LTR: ‘Long Tandem Repeat’ son secuencias muy largas con capacidad para replicarse de manera autónoma.
  • LINEs: Son secuencias más cortas que las anteriores, también con capacidad autónoma.
  • SINEs: Son secuencias cortas, que no tienen capacidad autónoma para replicarse.

Normalmente estas secuencias disponen de una región promotora para una enzima llamada ‘ARN Polimerasa III’. Esta enzima lo que hace es crear moléculas de ARN usando el ADN como molde. La capacidad autónoma se refiere a otra enzima, llamada ‘Transcriptasa inversa’ que convierte ese ARN de nuevo en ADN. Los SINEs no tienen en su estructura la secuencia que puede producir una Transcriptasa Inversa (TI). Un ejemplo son las ‘secuencias Alu’.

Por tanto, lo que distingue a los retrotransposones de los genes es que los dos se ‘transcriben’ a ARN, pero ese ARN sigue dos caminos distintos. El ARN que proviene de los ‘genes’ y que se llama ARN mensajero (ARNm) se irá a sintetizar una determinada proteína, mientras que el ARN de los retrotransposones se volverá a convertir en ADN para reincorporarse al genoma en otra parte.

Mucho se ha dicho sobre estos ‘elementos móviles’ descubiertos por primera vez por Barbara McClintock en la planta del maíz (estos elementos móviles son enormemente abundantes en el genoma de las plantas, pero en realidad lo son en todos los organismos incluyendo las bacterias). Todavía hoy en día, se les considera secuencias ‘fósiles’ que permanecen en el genoma sin cumplir ninguna función, o que la mayoría de ellos son inactivos mientras solo una minoría, por pura casualidad, tiene alguna importancia o función. Ya se sabe que hay algunos de ellos que participan en el control de los genes y en dar forma a la estructura de los cromosomas (la cromatina) y están detrás del ‘bandeado de color’ de ellos.

[IMG]https://i0.wp.com/i62.tinypic.com/eun2oi.jpg[/IMG]

Ahí está un dibujo muy burdo de nuestros cromosomas (se numeran empezando por el más grande) y en estas estructuras es que se copia y transmite nuestro ADN. En ellos se distinguen diferentes regiones y se sabe que presentan bandas, las cuales se hacen visibles con diferentes tinciones o colorantes. Bajo una tinción específica, se hacen visibles dos tipos de bandas: las bandas ‘R’ y las bandas ‘G’. No es casualidad: los ‘genes codificantes de proteínas’ se concentran en las bandas R y son las partes más activas de los cromosomas. Las bandas G abundan en ‘heterocromatina’ o parte más inactiva del ADN. Pues atento a esto: las secuencias ‘Alu’ en nuestro genoma son mucho más frecuentes en las zonas que corresponden a los ‘genes codificantes de proteínas’ mientras que los LINEs lo son en las bandas G. De hecho, hay una correlación inversa entre SINEs (secuencias ‘Alu’) y LINEs: allí donde hay más de uno hay menos del otro.Concretamente, ello parece indicar que cumplen una función inversa dentro del genoma. La zona donde menos secuencias ‘Alu’ hay es en los telómeros, los extremos de los cromosomas.

Esta correlación inversa no se debe a una distribución casual de los elementos, como tampoco la estrecha asociación entre secuencias ‘Alu’ y genes para proteínas. Aunque el mecanismo con el cual los ‘Alu’ se copian a si mismos y se incorporan en otro lugar del genoma no está del todo clarificado aún (no se sabe como hace uno de los dos cortes necesarios, por ejemplo) se sabe que los SINEs utilizan la maquinaria enzimática (proteínas que hacen ‘la copia, el corta y el pega’ por así decirlo) que tienen los LINEs, tomándola como prestada. Es por ello que hay una evidente relación entre los dos tipos de elemento móvil.

Lo más extraño de todo es el origen y la evolución de las secuencias ‘Alu’. Estas se expandieron de manera coincidente con la radiación de los primates hace 65 millones de años (MA). Hoy en día sabemos de dónde vienen, y es que en origen procedieron de una molécula de ARN que está en todos los seres vivos, que se llama Partícula de Reconocimiento de la Señal (PRS).

[IMG]https://i0.wp.com/i57.tinypic.com/nlrb12.jpg[/IMG]

Bueno es solamente una imagen, que muestra una molécula de ARN (la que está enroscada en hélice) rodeada de proteínas. El conjunto se llama ‘ribonucleoproteína’ (ARN + varias proteínas). El ARN 7SL es el que ha dado origen a las secuencias ‘Alu’. Por alguna razón desconocida, se comenzaron a expandir por el genoma de los primates copias de una parte de esa molécula de ARN y que está presente en todos los seres vivos formando parte de la PRS. Pero solamente en los primates ese ARN se ha expandido para dar lugar a ‘secuencias Alu’. Pero esto no ha sido un fenómeno único en la evolución. Existen otro tipo de SINEs en otros muchos grupos que no vienen de este ARN 7SL, pero pueden venir de un ARN de transferencia (ARNt) o de otras moléculas complejas de ARN.

Son varios los enigmas sobre esto, entonces hago estas preguntas:

– ¿Qué hizo que en la historia evolutiva de los primeros primates un ARN encargado del transporte de proteínas (la PRS tiene esa función) se convirtiera en un retrotransposón?

– ¿Cómo influyó esto en la evolución de los primates?

– ¿Por qué el ritmo con que se hacían copias de secuencias ‘Alu’ ha cambiado en la evolución de los primates? Porque se sabe que hace 40 millones de años, se producía [como media estimada] una nueva copia por cada nacimiento, en cambio hoy se estima una nueva copia y recolocación por cada 200 nacimientos.

– ¿Qué función pueden tener los SINEs y los LINEs en los genomas y la evolución de las especies, en general? ¿Y cómo están controlados?

ANIMAOS A COMENTAR Y PREGUNTAD TODO LO QUE NO ENTENDÁIS BIEN!

marzo 21, 2014 Posted by | Biología, Evolución de la vida, Misterios y enigmas. | 17 comentarios

MAPA PARA SUMERGIRTE Y DESCUBRIR ESTE BLOG.

Por desgracia no sé diseñar mejor páginas web, me gustaría que hubiera un panel o portada donde pudiérais acceder a todas las entradas de este blog directamente, sin tener que ir bajando y rebuscando si por casualidad queréis ir a alguna en concreto… Además, lo que escribí hace meses se queda atrás, por eso voy a publicar aquí todas las entradas por orden de publicación (primero las más antiguas), espero con eso dar una idea más global de este blog y un acceso más claro a los distintos artículos. Esto lo iré subiendo de tiempo en tiempo, para que sea accesible. Un saludo!

ENERO 2012

FEBRERO 2012

MARZO 2012

ABRIL 2012

MAYO 2012

JUNIO 2012

AGOSTO 2012

SEPTIEMBRE 2012

OCTUBRE 2012

NOVIEMBRE 2012

DICIEMBRE 2012

ENERO 2013

FEBRERO 2013

MARZO 2013

ABRIL 2013

MAYO 2013

JUNIO 2013

AGOSTO 2013

SEPTIEMBRE 2013

OCTUBRE 2013

NOVIEMBRE 2013

DICIEMBRE 2013

ENERO 2014

FEBRERO 2014

MARZO 2014

ABRIL 2014

MAYO 2014

JUNIO 2014

JULIO 2014

AGOSTO 2014

SEPTIEMBRE 2014

OCTUBRE 2014

NOVIEMBRE 2014

DICIEMBRE 2014

ENERO 2015

FEBRERO 2015

MARZO 2015

ABRIL 2015

MAYO 2015

JUNIO 2015

JULIO 2015

AGOSTO 2015

SEPTIEMBRE 2015

OCTUBRE 2015

NOVIEMBRE 2015

DICIEMBRE 2015

ENERO 2016

FEBRERO 2016

MARZO 2016

ABRIL 2016

MAYO 2016

JUNIO 2016

JULIO 2016

AGOSTO 2016

OCTUBRE 2016

NOVIEMBRE 2016

DICIEMBRE 2016

FEBRERO 2017

MARZO 2017

ABRIL 2017

MAYO 2017

JUNIO 2017

JULIO 2017

OCTUBRE 2017

NOVIEMBRE 2017

MARZO 2018

ABRIL 2018

MAYO 2018

JUNIO 2018

gran-agujero-azul-belice-3.jpg

BUENO AMIG@S YA PODÉIS ACCEDER DIRECTAMENTE A TODAS LAS ENTRADAS DE ESTE BLOG Y PARTICIPAR EN TODOS LOS DEBATES QUE OS INTERESEN, ESPERO QUE LAS DISFRUTÉIS!

marzo 13, 2014 Posted by | Uncategorized | 27 comentarios

¿INFORMAD@ SOBRE EL PLÁSTICO?

Si las personas estuviesen mejor informadas sobre las consecuencias del uso del plástico, de la manera en que se lo utiliza hoy, admitirían enseguida que los productos de plástico son objetos peligrosos. Pero por desgracia estamos frente a otro de esos temas en torno a los cuales se hace un vacío inmenso, que hace que el común de las personas ignore completamente la verdad. Desde este blog, además de dedicar esta entrada a informar un poco sobre este tema, quiero animaros a tod@s a descubrir por vosotros mismos a dónde va o termina el plástico que se desecha en vuestras ciudades o regiones. La idea que se transmite o pretende hacer creer es que si el plástico es colocado en los contenedores amarillos de manera apropiada, estos serán gestionados por alguna empresa de reciclaje. Esto es, en esencia, una creencia errónea. Tenemos que tener en cuenta el dato de que en torno al 70% de los plásticos NO van al contenedor amarillo, o del color que toque en cada país, por lo que estos se eliminan como Residuos Sólidos Urbanos (RSU) y no son reciclados. El dato real es que en Estados Unidos solamente se recupera el 7% y en países de la UE un 25%.

Sin embargo, te hago una pregunta, ¿cuánto sabes acerca del proceso de reciclado del plástico? Salvo que te dediques a ello de forma especializada, lo más probable es que no sepas prácticamente nada (me incluyo en esto). Y esto es deliberado: el plástico es un material bastante difícil de reciclar para producir objetos de calidad pareja a aquellos de origen. Esto significa que, con suerte se harán objetos los cuales a su vez no podrán reciclarse más. Al final acabarán en el medio ambiente. Esto es llamado por algunos ‘retrociclaje’ pues solamente retrasas su liberación al medio.

Copio un fragmento de esta web: http://elplasticomata.com/crisis-global/el-espejismo-del-reciclaje/

‘Años de adoctrinamiento y de un enorme gasto de dinero público han dado lugar  a sofisticados sistemas de recuperación de algunos tipos de plástico (como el PET) en varios países europeos.

La industria menciona estos sistemas como ejemplos de que el reciclaje de plásticos es una solución verdadera y sostenible y los gobiernos les secundan en esta falacia para no tener que dar explicaciones ante los ciudadanos por haberse convertido en basureros al servicio de una de las industrias más poderosas del mundo. Veamos lo que ocurre en realidad.

Según las propias cifras de la industria, en Europa se recuperan sólo en torno al 25% de los plásticos que se producen. Dentro de ese 25%, en términos de residuos generados por los consumidores europeos, en 2011 se recuperaron 14.3 millones de toneladas, un 58%.  Parece que no está mal como cifra, pero ¿a dónde va todo este plástico recuperado? Un 25% de esa cantidad, 3.4 millones de toneladas, se exportan, casi todo a China. ¿ Y qué pasa con el resto?  En países como Alemania o los países nórdicos más de la mitad es quemado en incineradoras. Osea que de cada cuatro plásticos que el consumidor europeo pone en un contenedor “para reciclar”, dos son quemados, y uno exportado a China (donde será quemado o usado en downcycling sin garantías ambientales ni laborales). ¿Y qué pasa con el 25% restante?  Dependiendo del tipo de plástico (¡hay miles!) y del lugar donde sea recuperado, pueden ocurrir tres cosas: que vaya directamente al basurero (lo más normal para muchos tipos de plásticos), que sea convertido en algo no reciclable (textiles, plásticos de baja calidad, etc) o, lo más raro de todo, que efectivamente sea convertido en un objeto parecido y que, que a su vez, sea reciclable de nuevo.  Este porcentaje mínimo residual sería la verdadera tasa de reciclaje real de Europa.  Una realidad  muy diferente a lo que quieren hacernos creer cuando nos animan a “reciclar”.

Esta es la lamentable verdad del reciclaje que nadie, ni los gobiernos, ni la industria, ni los que se lucran con todo esto quiere que sepamos.’

¿No crees que estos datos sean ciertos? Bueno, entonces te animo a investigarlos, y si encuentras una fuente de información fidedigna que no sea seguir al camión de la basura para ver a dónde se lleva (cosa que hizo Michael Moore en Estados Unidos, descubriendo que el reciclaje es una gran mentira al menos en ese país) dinos cuál es.

Lo cierto y el hecho incontestable, es que una gran parte de los plásticos, la gran mayoría, terminan en el mar. Esto no lo discute nadie. Existen en total cinco giros de corrientes en los océanos que albergan una ‘sopa de plástico’ originada por cualquier tipo de plásticos flotantes. El efecto de estas mareas de basura en los animales marinos es incalculable. Aquí pueden ver sus efectos en las islas Midway:

No solamente los albatros sufren las graves consecuencias de la ingesta, la intoxicación, la contaminación o el enredo debido al plástico. Muchísimos peces ingieren las diminutas partículas de plástico que se generan, aquí pueden oír a Charles Moore quien fue el descubridor por casualidad de la sopa de plástico en el Atlántico Norte, y sus estudios acerca del contenido de plástico en los peces, por ejemplo.

¿Qué decir de noticias como ésta en el Mediterráneo?

http://nuestra-tierra.laverdad.es/medio-ambiente/contaminacion/2165-250-000-millones-de-particulas-de-plastico-flotan-en-el-mediterraneo

Cualquiera que haya recogido plásticos en alguna playa, no importa cuál, se habrá encontrado con animales destruidos por el plástico: erizos, estrellas de mar, pájaros, etc.

En fin, quiero animaros a tod@s a pensar en este tema, a dejar de utilizar plásticos en la medida en que os sea posible, y también a organizar cuando tengáis tiempo con vuestros conocidos, limpiezas de playas, ya que ni siquiera en los sitios más turísticos los ayuntamientos o gobiernos se ocupan de esto, y tampoco en general empresas privadas. Una faena voluntaria que beneficia a humanos y animales. Haz fotos de los animales afectados que encuentres y enviálas a este blog.

[IMG]https://i2.wp.com/i62.tinypic.com/20tfod1.jpg[/IMG]

Una vez más quiero honrar a este animal que murió por ingestión de plásticos y que apareció varado en Holanda. Como simbólico de todas las muertes parecidas.

http://www.24horas.cl/internacional/holanda-hallan-ballena-muerta-con-plastico-en-su-estomago-930044

marzo 12, 2014 Posted by | Actualidad, Cambio climático / Ecología, Cuidemos el planeta. | 25 comentarios

¿QUÉ SIGNIFICA SU DESAPARICIÓN? (PARTE ii)

Hasta ahora hemos hablado de algunos animales que están amenazados GLOBALMENTE es decir, en el conjunto del área que ocupan. Las amenaza la desaparición total. Hay más especies en esta situación, y propongo esta entrada para dar a conocer y hablar de unas cuantas más, pero pensad que si nos fijáramos solamente por ejemplo en un país (España) el número de especies amenazadas en éste y no fuera se multiplicarían. Por ejemplo, el quebrantahuesos o el oso pardo no están en situación crítica en conjunto, pero sí  dentro de España y eso también es importante para los españoles. Si nos fijáramos solo en el Mediterráneo, veríamos que todo él está altamente degradado y contaminado, hecho que es favorecido por ser un mar casi cerrado.

Bueno, empiezo contando sobre un fascinante pez, al que estamos conduciendo a una desaparición casi segura.

ANGUILA EUROPEA (Anguilla anguilla)

[IMG]https://i1.wp.com/i57.tinypic.com/24nn2h0.jpg[/IMG]

La anguila fue un pez misterioso durante mucho tiempo. No fue hasta el siglo XIX que sus larvas transparentes (Leptocephalus) fueron asociadas a la misma especie, ya que son muy distintas. Hoy sabemos que las anguilas maduras van a reproducirse hasta el Mar de los Sargazos, un giro de corrientes donde unas algas flotantes han creado un increíble ecosistema, y muchas especies adaptadas solamente a este lugar. Las anguilas se sumergen a gran profundidad y ahí realizan la freza (las hembras liberan huevos al agua y los machos el esperma) después las larvas transparentes comienzan una migración hacia los ríos europeos, guiadas por la Corriente del Golfo. En cuanto contactan con el agua dulce, su piel toma color y continúan ascendiendo los ríos. En su fase de entrada, cuando son juveniles, se realiza la pesca de lo que luego es vendido como ‘angula’ o ‘gula’. Ya podéis imaginar su elevado número. Estos juveniles son capaces de atravesar todo tipo de obstáculos e incluso reptar a través de la hierba o el barro. Pasan un buen número de años mientras crecen en los ríos, a veces hasta la edad de 20 años. Cuando maduran, vuelven al mar para la reproducción. Son animales que han podido llegar a vivir hasta 85 años, aproximadamente lo mismo que un ser humano. Aún nos quedan cosas por saber de este increíble ser. Y puede que nunca las descubramos…

http://en.wikipedia.org/wiki/Eel_life_history

Ya que sobre este animal penden una serie de amenazas muy graves, y se da por muy probable su total extinción. Mi opinión es que la captura de esta especie debería prohibirse, cosa que no se ha hecho. No es sorprendente que la contaminación de los ríos así como el llamado ‘Mar o Sopa de Plástico del Atlántico Norte’ estén también afectando a esta especie, dado que la sopa plástica coincide bastante con el Mar de los Sargazos (imagináos cómo debe de estar la zona…). No obstante su principal amenaza actualmente parece ser la piscicultura. La anguila está siendo cultivada en granjas por parte de países como Alemania, España, Italia, Grecia, Dinamarca o Suecia. Para esta industria, se necesitan capturar juveniles salvajes.

Otro grave problema asociado es que el cultivo en granjas acuícolas de la anguila japonesa, ha contagiado un nematodo (gusano) a las anguilas europeas, que vive y degrada lentamente sus vejigas natatorias. Este parásito se llama Anguillicoloides crassus [ http://en.wikipedia.org/wiki/Anguillicoloides_crassus ]

Aquí tenemos otro ejemplo de cómo la acuicultura 1) No sería necesaria si no desapareciera la especie en su ambiente natural 2) Ocasiona la pérdida de la especie salvaje.

[IMG]https://i1.wp.com/i57.tinypic.com/m83f9u.jpg[/IMG]

LINCE IBÉRICO (Lynx pardinus)

[IMG]https://i1.wp.com/i60.tinypic.com/11j0ifd.jpg[/IMG]

Es el mamífero más amenazado de Europa y una especie emblemática de España. Son felinos que se alimentan básicamente de conejos, y su declive aparte de a la caza, se debe a la fragmentación de los bosques debido a urbanizaciones, carreteras, campos, industrias, etc. A pesar de haber programas tanto de protección y seguimiento como de cría en cautividad, no dejan de disminuir debido a accidentes, atropellos, envenenamientos no dirigidos a ellos o caza ilegal. Una prueba de la degradación de los bosques en todo nuestro país. Además, hay que añadir la disminución de conejos silvestres (se han reducido un 30% en los últimos 10 años sobretodo debido a enfermedades como la mixomatosis o la neumonía). Esta especie tiene el futuro muy difícil y es que nos dedicamos a intentar salvar especies en vez de detener las causas que les impiden mantenerse a si mismas. 14 individuos fueron atropellados en 2013. Actualmente su número oscila en torno a los 300. El mayor núcleo se encuentra en el Parque Natural de la Sierra de Andújar (Jaén) y en el Parque Nacional de Doñana.

ESTURIÓN EUROPEO (Acipenser sturio)

[IMG]https://i0.wp.com/i59.tinypic.com/9pxk01.jpg[/IMG]

Realmente no valoramos el valor que tienen las especies, no solamente por su función ecológica, sino por la historia evolutiva que tienen (por el mismo motivo que sería importante conservar los restos de una antigua civilización hoy desaparecida). Este es el caso del esturión, un pez que tiene en común con los tiburones un esqueleto hecho de cartílago y no de hueso (solamente una parte del cráneo y de la aleta dorsal son de tejido óseo). Provienen de un linaje de peces con una antigüedad de más de 200 MA (millones de años).

Hace no muchas décadas era muy común en todo el Mediterráneo, costas de África del norte atlánticas e incluso el Mar Negro. Le pasa justo lo contrario que a las anguilas, mientras que las anguilas son peces que pasan su vida en los ríos y van al mar a reproducirse (especie catádroma) el esturión pasa su vida en el mar y acude a los ríos a reproducirse (especie anádroma). Durante la década de 1990 podía verse en el río Guadalquivir sin ir más lejos, y era abundante en todos los ríos de nuestro país. Hoy sin embargo no existen ya lugares de freza en nuestros ríos adonde acuda el esturión. Básicamente, necesitan lugares con fondos de grava para liberar huevos y esperma. Necesitan también ascender un largo recorrido río arriba, esto es simplemente bloqueado debido a la construcción de presas. La contaminación y las especies invasoras son otro problema adicional.

A esto, tenemos que añadir que ha sido una especie intensamente cazada debido a las huevas que producen las hembras, y que se cotizan a un precio muy elevado como caviar (un tipo de caviar llamado ‘roe’ en inglés, no encontré su nombre castellano, si lo saben díganlo).

Esta especie puede llegar a vivir hasta 118 años, y no es raro que superen el siglo.

Ojalá este blog contribuya a que la gente conozca estas especies (ya que a través de los medios de comunicación, que no informan de nada útil, es francamente difícil enterarse). Pienso que sería una verdadera lástima que esta especie desapareciera. Tal vez todavía haya esperanza, ya que se sabe que uno de los pocos lugares donde este pez aún va a frezar es el río francés Garona. Hay sin duda que abrirle otras posibilidades. No estaría de más mirar otros efectos negativos que nuestras presas causan en los ríos.

[IMG]https://i2.wp.com/i61.tinypic.com/nbcill.jpg[/IMG]

NÁYADE AURICULADA (Margaritifera auricularia)

SAMARUC (Valencia hispanica)

[IMG]https://i0.wp.com/i59.tinypic.com/343qcgj.jpg[/IMG]

Este pez vivía hace tiempo en muchas zonas del levante español conocidas como ‘marjales’ es decir, lugares próximos a la costa y con abundante vegetación. Concretamente ocupa un área que va desde Vinarós (Castellón) hasta el marjal de Pego-Oliva (Valencia-Alicante) pasando por ejemplo por la Albufera de Valencia (parque natural desde 1986) y donde actualmente se han creado reservas protegidas para este pez. Si miramos la evolución de la Albufera con el tiempo, veríamos que antes ocupaba un área mucho mayor. La mayor parte del terreno del lago ha sido convertido en arrozales, utilizando el método de riego por inundación. Al no convertir estos terrenos en huerta, todavía permiten la supervivencia de los animales autóctonos. Entre los campos de arroz existen los ‘ullals’ que son pequeñas lagunas donde viven este tipo de peces. Sin embargo, el drenaje de tierras, la explotación del agua y diversas urbanizaciones construidas en el propio Parque, han puesto a seria recesión el ecosistema de la Albufera.

http://www.albufera.com/parque/content/urbanizaciones-y-vertidos-asedian-los-humedales-pese-la-catalogaci%C3%B3n

Otro tipo de amenazas penden sobre el ‘samaruc’ u otros peces semejantes y propios de las costas mediterráneas españolas como el fartet (Aphanius iberus) también de la familia de los ciprinodontiformes. Aunque este ocupa un área algo más al norte y al sur que el samaruc, también lo amenazan los mismos motivos (explotación y contaminación de acequias, urbanización, drenajes, etc). A esto hay que añadir las especies introducidas, algunas de ellas compiten con estas especies caso el de la ‘gambusia’ un pez similar pero traído de África, o el cangrejo rojo americano, del que os voy a hablar a continuación.

[IMG]https://i1.wp.com/i59.tinypic.com/2e6c841.jpg[/IMG]

CANGREJO DE RÍO EUROPEO (Austropotamobius pallipes lusitanicus)

[IMG]https://i0.wp.com/i60.tinypic.com/bg2x39.jpg[/IMG]

Esta imagen es del cangrejo de río propia de los ríos de toda Europa. Viven en aguas tranquilas o de no demasiada corriente. Cuando son jóvenes, se cobijan entre las plantas que crecen dentro del agua (como el mastuerzo de agua). Otra posibilidad donde resguardarse es bajo raíces o grietas de las rocas. Esta especie ha sido sustituida de forma impactante por otra especie, el cangrejo rojo americano (Procambarus clarkii) el cual fue introducido en los 70 en Estaña para producirlo comercialmente (en granjas ubicadas en ríos) desde las marismas de Louisiana. El cangrejo se expandió por nuestro país, no solo compitiendo con el autóctono, sino transmitiéndole un hongo que le causaba una enfermedad, la afanomicosis. Hay que decir que existe otra especie que ha sido introducida en Europa, y que también es resistente a la afanomicosis, el cangrejo señal (Pacifastacus leniusculus) también introducido desde Estados Unidos y frecuente ya en Europa. Todo esto, mientras en cangrejo de río autóctono ve reducida sus poblaciones en casi todas partes, salvo en las zonas más próximas al origen de algunos ríos europeos, con aguas muy frías y claras.

Aquí tenéis un nostálgico video que por su musicalidad creo que le correspondería más al cangrejo europeo, sin embargo el que muestra es el cangrejo rojo.

marzo 10, 2014 Posted by | Actualidad, Biología, Cambio climático / Ecología, Cuidemos el planeta. | 5 comentarios

“The cracking Chispmouse Bloggywog Award”

[IMG]https://i0.wp.com/i58.tinypic.com/2wfvjia.jpg[/IMG]

Qué bueno estar nominado a ‘The cracking chrispmouse bloggywog award’ aunque al principio no sabía lo que era, me parece una idea muy positiva y desinteresada en la que no te piden publicitar ninguna costumbre de cierto costo o algún producto banal. Además parece una buena oportunidad para ayudar a otros blogs, en la medida en que pueda hacerlo así que me apunto.

Dar las gracias a Hermes da Vinci, del blog Me Llamo Tierra por haber pensado en este humilde blog !

Bases de “The Cracking Chrispmouse Bloggywog Award”

1) Mostrar el logotipo del premio en el blog. [Hecho]

2) Enlazar a quien te ha nominado. [Hecho]

3) Enumerar 7 cosas sobre mí. [Hecho]

A. Fanatico es el que llama fanatico a todo el que no esta de acuerdo con el.

B. Una vez asegurado el pan, el tiempo libre es el objetivo máximo.
(Kropotkin) ¿Quien puede no estar de acuerdo con esto?

C. La musica belica y para los soldados es musica alegre, para ocultarles la realidad de su papel, para cubrir de gloria una tragedia.
La musica melancolica y depresiva tiene el mismo efecto que el vino en personas depresivas. Pero solo sus efectos positivos.
Es como si le quitaras el alcohol y solo bebieras la esencia del vino, a traves de los oidos.

D. La ciencia es tan estimulante como la musica, tiene el mismo nivel de creatividad.
Lastima que no se entienda asi por casi nadie!

E. Me arrepiento de todo lo que he leído o aprendido y a lo que no le he podido dar ninguna utilidad práctica.

F. Limpiar una playa de plásticos vale más que descubrir una mina de oro.

G. Me ha costado varios años de dejar los estudios para recordar por que me gustaba la ciencia.

4)  Nominar a otros 15 bloggers (más o menos) para este premio. [Hecho]

http://elparnasillo.blogspot.com.es/

http://plumanegra45.wordpress.com/

http://pedrogarciaolivo.wordpress.com/

http://www.quebrantandoelsilencio.blogspot.com.es/

http://gazzettadelapocalipsis.com/

http://antoniogarciatrevijano.com/

http://mellamotierra.wordpress.com/

http://elreflejoenlaventana.wordpress.com/

http://informacionporlaverdad.wordpress.com/

http://estoesparti.blogspot.com.es/

http://franciscojaviertostado.com/

http://laverdadofende.wordpress.com/

http://www.voltairenet.org/es

http://armakdeodelot.blogspot.com.es/

http://hegemonialibertaria.wordpress.com/

5.Poner un enlace a los blogs nominados y comunicárselo con un comentario. [No he podido hacerlo con todos, pero hecho en su mayoría]

marzo 8, 2014 Posted by | Uncategorized | 2 comentarios

¿QUÉ SIGNIFICA SU DESAPARICIÓN?

Hola, voy a hablaros de un tema que por desgracia no sale apenas en los medios de comunicación ni en la prensa, o cuando lo hace es demasiado tarde. La humanidad continúa con su crecimiento económico, su demanda comercial por persona de diferentes bienes es siempre superior y se incrementa en aquellos mal llamados ‘países en desarrollo’ donde las personas han de aceptar un estilo de vida, ligado a un estilo de producción y consumo, parejo al ‘occidental’ o ‘del viejo mundo’ como lo llamaban en la época de la colonización. Es lamentable pero lo que la mayoría entiende por ‘desarrollo’ no tiene que ver con el bienestar de la gente, salud, buena alimentación, nexos culturales y colectivos fuertes, libertad, etc, sino que la gente entiende el desarrollo social en términos de PIB, exportaciones al extranjero, producción de petróleo, oro, diamantes o marfil… producción de lo que sea que dé dinero, he ahí el desarrollo.

Bueno y ¿a qué viene todo esto? Pues a que  ese modo de ‘avanzar’ esa necesidad continua de lucro, nos hace exterminar a las especies y medios naturales que nos rodean un problema que ha llegado a un estado muy grave por todas partes. Es increíble lo inconsciente que la mayor parte de la gente es acerca de la degradación de la naturaleza incluso en  sus propias regiones. Parece haber un gran vacío de información al respecto, no de que la naturaleza va degradándose o de la extinción de especies, cosa que sí se sabe  aunque solo algunos detalles mediáticos aparecen en los medios, sino del análisis de las causas que producen ese problema o ese hecho. Cuando veo por ejemplo a GreenPeace pidiendo reducción de emisiones de CO2, sinceramente me pregunto a quién obedece, ya que centrar en el aumento del CO2 y su teórico aumento de la temperatura planetaria (el cual es más que discutible, como los datos climatológicos prueban, arguyendo que ‘el calentamiento se ralentiza’) la destrucción de la naturaleza o el hambre en el mundo es el mayor disparate que puede entrar en cualquier mentalidad humana de este planeta, sin embargo hay gente que cree en tal endeble argumento ignorando las causas reales y no meramente especulativas de la muerte de especies y retroceso de entornos.

Mi propósito con esta entrada es hablaros de algunas especies que tenemos realmente cerca, porque o viven o han vivido en algún momento en España, pero también debatir sobre las causas, o la importancia del tema que normalmente se ve como ajeno y se infravalora. Es un tema que está relacionado también con la vida humana, ya que el estilo de vida en las grandes urbes es completamente artifificial y dependiente del comercio desenfrenado y creciente que es el que, como efecto lateral, pone a muchas especies en riesgo de extinguirse.

EL VISÓN EUROPEO (Mustela lutreola)

[IMG]https://i2.wp.com/i57.tinypic.com/654a2x.jpg[/IMG]

Une especie ligada a las riberas de ríos cubiertas de vegetación alta y de bosque, hasta el siglo XIX ocupaba prácticamente toda Europa. A día de hoy, su población se ha reducido a unos cuantos puntos aislados.

[IMG]https://i0.wp.com/i58.tinypic.com/2wcpsmw.png[/IMG]

Por lo que en España nos toca, continúa viviendo en zonas de Navarra, el País Vasco, sobretodo en afluentes de la cuenca del Ebro. Estas especies son indicativas de los entornos donde viven es decir, si vemos decaer a este animal, es que también las áreas de bosque, hace tiempo ocupando la totalidad de Europa, han sido o bien destruidos o bien fragmentados. Si nos centramos en su área española actual, bueno se sabe que el río Ebro es uno de los más contaminados del país. Hay componentes que pueden causar la muerte o afectar a la capacidad reproductiva de estos animales, lo cual es otro factor. Pero también y en el que se están centrando más los gobiernos según parece, es en el desplazamiento por el visón americano, que se escapa de las granjas donde se los cría para conseguir su pelaje. Podéis ver aquí un video sobre el tema:

Un claro motivo para oponerse a esta industria peletera del visón (aunque estoy en contra de liberar a los visones americanos, por supuesto, pues hay que proteger al europeo). Como véis no solo se trata de una especie de más o menos, sino que su desaparición indica algo más general.

BALLENA FRANCA SEPTENTRIONAL O BALLENA VASCA (Eubalaena glacialis)

[IMG]https://i1.wp.com/i60.tinypic.com/11vqlol.jpg[/IMG]

Antiguamente abundante en todo el atlántico norte (la población del hemisferio sur Eubalaena australis se considera una especie separada, ya que habitan en aguas frías y no tienen contacto entre ellas) hoy se estima que queden entre 300 y 600 ballenas. Es muy probable que la población que antiguamente habitaba la parte europea y africana (oriental en conjunto) del Atlántico norte esté casi completamente extinta. Solamente se localiza algún escaso ejemplar cerca de las costas del Sáhara, concretamente hubo algún avistamiento en Dajla (= Villa Cisneros)  pero salvo por esta rareza, ha desaparecido. Es más común en la zona americana, donde acude a alimentarse al golfo de Maine. No obstante, la amenazan redes de pesca, choques contra las hélices de los barcos que literalmente las rebanan el cuerpo (son especialmente propensas a los choques) los plásticos que ingieren, los ruidos de las actividades industriales, etc.

Es conocida como la ballena ‘acertada’ o ballena ‘vasca’ ya que fue materia de una floreciente industria en siglos pasados. Su contenido elevado en grasa le hace difícil el hundirse para evitar a los balleneros, y cuando muere tampoco se hunde, por lo que era muy fácil de cazar y por lo tanto muy lucrativa (a menos esfuerzo se consigue más). Pese a estar actualmente prohibida su caza, ya sabemos cómo funciona la normativa en cuanto a la caza de ballenas… (mirad el documental The Cove) y aunque no sé si se cazan activamente, sí que mueren por todo lo dicho antes. Posiblemente desaparecerán.

La única solución para esta especie además de impedir cualquier cacería intencional, sería global, es decir, eliminar la contaminación y los residuos plásticos al océano que amenazan a miles de especies. Supongo que también pueden hacerse programas de recuperación específicos para la especie, sobretodo de protección, un seguimiento de cada individuo, disminuir el tráfico por ciertos lugares de paso, etc. o reducir la agresividad de las hélices. Al ritmo que esto va, no le veo mucho futuro.

Podéis escuchar sus sonidos aquí: http://csi.whoi.edu/audio/rightwhale-audio

[IMG]https://i0.wp.com/i62.tinypic.com/5w06mt.jpg[/IMG]

FOCA MONJE DEL MEDITERRÁNEO (Monachus monachus)

[IMG]https://i1.wp.com/i60.tinypic.com/2weyzr9.png[/IMG]

Esta es otra especie que hace siglos era muy abundante en todo el Mediterráneo, incluso en las costas atlánticas del norte de África, Canarias, islas de Madeira y Cabo Verde. Actualmente quedan solamente grupos muy reducidos, siendo el mayor de todos el de Grecia, las islas del Mar Egeo y Chipre, de unos 400 individuos. Habitan normalmente en cuevas de las rocas, en lugares de difícil acceso, y esto es lo que las ha salvado de su completa desaparición. Personalmente, creo que si se hacen programas de vigilancia, seguimiento y protección eficaces, se podría salvar a esta especie, de hecho ya se la ha reintroducido en algún sitio. En España solamente habitan en las islas Chafarinas, una pareja.

No hay que olvidar que ya en su día declaramos extinta a la foca monje del Caribe, y que cada año se realizan masivas matanzas de focas como si fuera una diversión en distintos puntos del planeta.

Tenéis en este enlace una muy buena descripción de su historia en España:

http://es.wikipedia.org/wiki/Monachus_monachus

Y abajo su área de distribución actual.

[IMG]https://i0.wp.com/i59.tinypic.com/j64x2w.gif[/IMG]

BUCARDO (Capra pyrenaica pyrenaica)

[IMG]https://i0.wp.com/i60.tinypic.com/2gy0zgo.jpg[/IMG]

El bucardo es una de los tipos de cabra de montaña que existen en España, concretamente en la zona de los Pirineos (en total se han diferenciado cuatro tipos o ‘subespecies’. Este animal estuvo muy extendido en siglos pasados, siendo cazado ya en tiempo de los neandertales. Se sabe que sus antepasados eran de una talla mucho mayor (el llamado bucardo gigante prehistórico). Fue objeto de una caza muy intensa sobretodo a partir de la segunda mitad del siglo XIX, que no cesó durante el siglo XX. El resultado ha sido su extinción, la última murió en el 2000. Además del bucardo también desapareció la cabra propia de Portugal llamada ‘mueyu’ o ‘cabro’ cuyo último ejemplar murió en 1892.

http://sociedad.elpais.com/sociedad/2012/12/26/actualidad/1356560651_304250.html

Es por esto que debemos valorar y en mi opinión detener la caza de la cabra hispánica (Capra pyrenaica hispanica) que aunque por el momento se estima que quedan entre 60.000 y 100.000 individuos en todo el país, su ecosistema también está fragmentado y que la caza, los incendios, la degradación del medio en algunas regiones y quizás accidentes las amenazan.

[IMG]https://i1.wp.com/i57.tinypic.com/2cg0gnt.png[/IMG]

http://zaragozasalvaje.blogspot.com.es/2013/09/solucion-la-cuestion-de-los-bucardos.html

marzo 8, 2014 Posted by | Actualidad, Biología, Cambio climático / Ecología, Cuidemos el planeta. | 8 comentarios

LA BUENA COMIDA HAY QUE BUSCARLA .

[IMG]https://i1.wp.com/i61.tinypic.com/ev6exl.jpg[/IMG]

Much@s de los que leéis este blog seguramente que viváis en alguna ciudad grande y por fuerza tenéis que recurrir al mercado para alimentaros, a productos que vienen de alguna fábrica, quizás en otro país, si no la manufactura, sí las materias primas que lo forman. Te propongo una aventura urbana: la de encontrar alimentos de buena calidad. Esto puede ser muy difícil no porque no se hagan productos de calidad, sino porque han sido sobrepasados por un tsunami de establecimientos donde la comida inevitablemente ha perdido muchas de sus propiedades: supermercados, panaderías, carnicerías, etc. A la larga, esta pérdida y este alejamiento del campo supone un grave problema de salud. Un problema del que se habla muy poco, por motivos evidentes. En esta entrada quiero darte algunos hechos objetivos sobre lo que solemos comprar e invitarte a buscar algo mejor, porque si la gente empieza a preocuparse de esto, con el tiempo una alimentación verdaderamente buena y saludable estará al alcance incluso de los que tienen menos dinero. Por desgracia, en el bajo precio los que ganan son auténticas porquerías. En otras entradas vimos  en parte qué alimentos necesita realmente el cuerpo. En este, propongo que busquemos lo mejor de ellos. Espero que os gusten estos consejos, siempre debatibles:

“Busca un pan que esté hecho con harina integral ya que tiene más nutrientes, que no tenga aditivos ‘mejorantes’ y que tenga un proceso de fermentación adecuado, es decir, evita el pan ‘precocido y congelado’ (que tanto la gente confunde con ‘recién hecho’ cuando lo compran calentito en el supermercado, en realidad está descongelado). Aquí tienen la opinión de un panadero

http://www.elmundo.es/elmundo/2013/03/23/valencia/1364068880.html

Busca carnes de animales que no hayan sido criados en estabulación, sino en pastizales abiertos, y que hayan comido pasto en lugar de piensos prefabricados (la mayoría de maíz importado de Estados Unidos u otros países). Hasta donde yo sé, solamente la ganadería ‘ecológica’ puede asegurar estas condiciones, semejantes al pastoreo dedicado a la producción de carne o al modo tradicional de criar animales en los pueblos. También creo que aunque no en todos sitios, el precio de esta carne es superior. Pero, dentro de un entorno urbano, creo que es difícil acceder de otro modo a carne que no haya sido producida en estabulación y nutrida con pienso. No solamente esto es bueno por los nutrientes que gana, sino por el sufrimiento que puede evitar en los animales. Otra alternativa son los animales salvajes de caza, si tienes acceso claro. Lo mismo se aplica a los huevos.

[IMG]https://i0.wp.com/i58.tinypic.com/2ql4i9k.jpg[/IMG]

[IMG]https://i2.wp.com/i62.tinypic.com/2rz5d2t.jpg[/IMG]

Consigue leche fresca no pasteurizada: Este es uno de los productos más difíciles de encontrar en una gran ciudad, la pasteurización se ha realizado por norma con toda la leche y lácteos habidos y por haber, para destruir las posibles bacterias patógenas de la leche. Y quizás es razonable y necesaria cuando los animales de los que se obtiene la leche son más propensos de lo habitual a las enfermedades, como es el caso de los que son criados en granjas industriales, estabulados. Sus sistemas inmunes, su estilo de vida y su nutrición les hacen más propensos. Es el mismo motivo por el que hay que atiborrar de antibióticos y vacunas a estos animales. Es precisamente la alimentación con proteínas animales a las vacas quien produjo aquello de las ‘vacas locas’. Tampoco he podido encontrar leche ‘ecológica’ que no esté pasteurizada. Sin embargo, este proceso elimina muchas propiedades nutricionales del producto (incluyendo para empezar, las propias bacterias que naturalmente se encuentran en cualquier leche). Además, reduce sus vitaminas, altera sus ácidos grasos, etc. La pasteurización consiste en calentar la leche a unos 60ºC durante varios minutos (menos de 1 hora) luego enfriar.

Evidentemente, debe de haber un control sobre la leche fresca o cruda para evitar contagios, pero es factible comercializarla. En esta página comparan la leche cruda con la pasteurizada.

http://vidasostenible.lacoctelera.net/categoria/la-verdadera-leche-esta-pasteurizada

Evita cualquier alimento que tenga estos aditivos, entre otros: Glutamato monosódico (GMS), nitrito de sodio, Butil-hidroxianisol/tolueno (BHA y BHT), colorante rojo cochinilla, Sirope de Maíz alto en fructosa, grasas vegetales, grasas trans. Todos ellos están demostrados o bien son altamente sospechosos de estar ligados a graves enfermedades como cáncer, diabetes o enfermedades del corazón. De todos modos aquí tenéis una lista completa:

http://www.e-aditivos.com/

No tomes alimentos procesados por ejemplo bebidas, refrescos, zumos, batidos, así como comidas precocinadas. ¿No es mejor tomar zumos de frutas hechos directamente, por ejemplo? Claro que lo es. Las bebidas enlatadas por ejemplo, son nada menos que agua cargada de colorantes, saborizantes… puro artificio. Muchos de ellos llevarán glutamato. Te recomiendo evitar al 100% tales productos. También comidas como pizzas precongeladas, y otros de semejante índole.

Si utilizas azúcar, rechaza el clásico azúcar blanco que es el más común y busca azúcar moreno. Lo mismo te digo para la harina (la mejor no tiene un color blanco). Con esto puedes hacer tú mismo todo tipo de bollerías, pan, pizza, crêpes… evitando así productos más procesados o con aditivos.

Rechaza el arroz blanco y cámbialo por arroz integral. Esto no cuesta nada y desde mi punto de vista sabe mejor.

Las verduras de temporada y cultivadas de una manera más ‘tradicional’ (por ejemplo no en cultivos intensivos o en invernadero) tendrán más sabor y mejores cualidades. Lo primero se evidencia en el poco sabor de muchas verduras y frutas de los grandes supermercados. No creo que necesariamente tengan que ser ‘ecológicas’ o ‘orgánicas’ pero si lo son, esto también garantiza un menor contenido en pesticidas y fertilizantes.

Aparte siempre es mejor favorecer aquellos productos que se producen en el propio país o región que no los que vienen de otros lugares, pero esto es un compromiso que se hace más por cuestión de que aquí hace falta empleo, y comprando estos productos no garantizas el empleo local. También seguramente su calidad sea superior en muchas ocasiones.

Evita el pescado criado en piscifactorías, y buscado pescado pescado, valga la redundancia, que haya sido pescado en mar o río. Y a ser posible que sea local. Esto se encuentra más en mercados locales. En los grandes supermercados, gran parte o bien es de piscifactoría o bien es importado de zonas muy alejadas del planeta. Aquí tienes un panorama objetivo de lo que son las piscifactorías y lo que sucede en ellas, y que no oirás por medio de la propaganda: LA DOBLE CARA DE LA PISCICULTURA

– El aceite ha perdido mucha calidad incluso en algunas marcas que afirman tener un aceite de oliva de calidad, es mentira. El aceite de buena calidad hoy en día se vende a un precio muy elevado.

http://www.elmundo.es/elmundo/2012/10/25/economia/1351173882.html

Hay incluso quien recomienda cocinar con mantequilla y no con aceite. Ya vimos en la entrada sobre las grasas, que no hay que hacer caso a la propaganda contra las grasas saturadas (como la mantequilla).

Bueno, espero que os gusten estos consejos y os animeis si os preocupa el tema a buscar buenos alimentos, que a la larga os nutrirán mejor y influirán positivamente en vuestra salud. Un saludo!

marzo 3, 2014 Posted by | Actualidad, Cuidemos el planeta., Salud humana y Nutrición | 7 comentarios

   

Druid Life

Pagan reflections from a Druid author - life, community, inspiration, health, hope, and radical change

LA NAVE VA

Aportaciones para la reflexión antropológica, filosófica y literaria

Para los que necesitan evolucionar

Reflexiones de crecimiento.. para una inmensa minoria.

Amor por la Vida sin "Sistema"

Textos de Artur y Fiona Cristian entre otros

Derribando el Muro

de las mentiras que nos esclavizan

Patricio Contreras

Un debate es una lucha que fortalece a todos los que participan.

SALIENDO DEL HIPERCUBO

Para salir del Hipercubo, del gran Laberinto de este mundo solo tienes que abrir la PUERTA del Conocimiento. Y tu eres el único con la LLAVE. Aúna tu MENTE, tu CORAZÓN y tu ESPÍRITU y únete a la BUSQUEDA de la VERDAD.

Analisis 06

Blog de analisis histórico, filosófico y espiritual sobre el ser humano y la auténtica historia, en la medida de lo posible.

Reflexiones Antropológicas

Pensamientos acerca del pasado y el ahora desde una perspectiva enfocada en el hombre y sus diversas manifestaciones.

Un rincón que te abrigue

Antes y después de ser mariposa

El foco

Reseñas de cine

How to blue

Un blog acerca mi vida personal sientete libre de juzgar.

DERRIBANDO EL MURO

Rompiendo el Paradigma

Reparaciones profesionales 24 horas

Servicio de-Cerrajero-Electricista-Fontanero-Persianista

Wanderlust

Blog personal | Bitácora de viajes

yosoytuprofe

Aprender ciencias es mucho más fácil de lo que te imaginas