Para Mí Son Enigmas

Un debate es una lucha que fortalece a todos los que participan.

ACERCA DEL GEN DE LA OBESIDAD.

Si veis la TV o la prensa puede que estos últimos días os hayáis cruzado con la noticia de que se ha encontrado un gen responsable de la obesidad, que hace que unas personas engorden más que otras aunque coman lo mismo. Quiero hacer unas reflexiones sobre este estudio y enlazarlo con otros en los que también se vincula un gen a la violencia (gen MAOA) o a la propensión a dormir más o menos (gen ‘despertador’) etc.  Se trata de un estudio realizado entre la Universidad de Chicago (EEUU) y el Centro Andaluz en Biología del Desarrollo de Sevilla y publicado el 12 de marzo de 2014 en la famosa revista ‘Nature’ (lo podéis ver abajo, aunque solo la introducción del estudio).

http://www.nature.com/nature/journal/vaop/ncurrent/full/nature13138.html

http://www.lanacion.com.py/articulo/159412–identificaron-al-irx3-o-el-gen-principal-del-engorde-humano.html

Lo que estos científicos han descubierto concretamente son dos cosas:

– Primero, que aquellas personas con una variante específica del gen FTO tienen, como media, un peso superior. Esto lo podéis ver en esta parte del artículo en Wikipedia:

‘A study of 38,759 Europeans for variants of FTO identified an obesity risk allele. In particular, carriers of one copy of the allele weighed on average 1.2 kilograms (2.6 lb) more than people with no copies. Carriers of two copies (16% of the subjects) weighed 3 kilograms (6.6 lb) more and had a 1.67-fold higher rate of obesity than those with no copies. ‘

[Un estudio de 38.759 europeos sobre variantes del gen FTO identificó un alelo de riesgo para obesidad. En concreto, los que tienen una copia del alelo pesaban como media 1’2 Kilogramos más que aquellos que no tienen ninguna copia. Los que tienen dos copias (que eran el 16% de los sujetos) pesaban 3 Kilogramos más y tenían una tasa de obesidad 1’67 veces superior a aquellos con cero copias.]

Voy a intentar aclarar lo que significa eso.

– Variantes del gen FTO: Un gen es una secuencia de ADN ubicada en los cromosomas. Dentro de la población humana, un mismo gen puede tener variaciones de secuencia respecto a otras personas (esto se llama polimorfismo). El ADN está compuesto por cadenas de cuatro ‘nucleótidos’ que se identifican con estas letras: A, G, C y T. Así, forman largas cadenas o secuencias de estas ‘letras’, por ejemplo:

AGGTCCGATTTAGCTGGATCGGATCGGATGCTGAGTCGATCG…

Pero los ‘genes’ que son solo aquellas partes del ADN encargadas de guardar información para fabricar proteínas, están divididos en varias partes que se llaman ‘intrones’ y ‘exones’.

[IMG]https://i2.wp.com/i60.tinypic.com/2hf8i8g.png[/IMG]

Estas son partes que se pueden incorporar o no a las proteínas finales, y esto es importante para lo del gen de la obesidad, porque la variante del gen FTO que está ligada a obesidad es una que tiene 1 de las letras cambiadas en un intrón. Los intrones son secuencias intercaladas en los genes que solo se incorporan opcionalmente a las proteínas, en la imagen de arriba, bastante buena y simple, lo que se ve es cómo solamente los exones al final se cortan y vuelven a pegar en el ARN mensajero (que luego irá a fabricar una proteína). Los intrones se eliminan y no se usan, en este caso, para incorporarlos a la proteína.

FTO es el ADN que se utiliza para fabricar la proteína FTO. Explicar la función de esta enzima lo veo ya bastante complicado para lo que es esta entrada, pero bueno si queréis os lo explico en los comentarios. Hablemos del intrón relacionado con la obesidad, y esta es la segunda cosa que han descubierto los científicos de este estudio.

– Ese intrón del gen FTO, en realidad es una secuencia reguladora de OTRO gen diferente y muy alejado del gen FTO. Esta segundo gen se llama IRX3 (o iroquois 3). Resulta, que la variante del gen FTO ligada a obesidad, lo es porque hace que el gen IRX3 se exprese más. Según los investigadores, una mayor expresión de IRX3 hace que el cuerpo tienda a acumular más grasa y es un factor de riesgo para obesidad.

Tenemos pues dos genes, uno que influencia al otro desde la distancia.

Entonces, se puede sintetizar todo el descubrimiento científico en dos puntos:

1) Aquellas personas con una variante concreta del gen FTO pesan en promedio algo más que aquellas que no la tienen.

2) Los animales a los que se ha suprimido el gen IRX3 (ratones ‘knockout’ por ejemplo, o ratones con el gen silenciado por ARN de silenciamiento, todo esto hecho por los propios científicos en laboratorio) son más delgados a pesar de comer una dieta elevada en grasa.

La conclusión es que la propensión a engordar es mayor en unas personas que en otras según su genética. Y esto no está mal saberlo, pero para estos investigadores: ‘los genes controlados por IRX3 pueden ser dianas para nuevos fármacos que permitan reducir la obesidad’. Pero resulta que el gen IRX3 no está solamente ligado a la obesidad, sino que él mismo controla a muchos otros genes, implicados por ejemplo en el desarrollo, en el sistema nervioso, etc… Es lo que se llama un ‘gen homeótico’. Esto lo convierte en una diana más que peligrosa para fármacos que lo inactiven, podría tener serios efectos secundarios.

Además, decir y transmitir a la gente que se ha descubierto un gen que hace más fácil la obesidad y achacarle a ese gen la responsabilidad es caer en lo que se llama el ‘determinismo genético’. La manera de prevenir la obesidad no es inactivar un gen, sino decirle a la gente que no coma comida basura, que haga más ejercicio o vea menos la TV. La conclusión de que esto abre una vía para la creación de nuevos fármacos etc, es más que interesada, imaginemos que se crean estos fármacos, con graves efectos secundarios, y que la gente los toma para adelgazar. ¡Esto significa, adaptar químicamente a la gente a un estilo de vida insalubre, sedentario y de mala alimentación! ¿Tal vez estas sean las intenciones del NIH (Instituto Nacional de Salud) de Estados Unidos, que es quien ha financiado esta investigación?

Es interesada por lo siguiente:

1) El hecho de que las personas con un determinado gen pesen un poco más en promedio que las que no tienen esa variante del gen, no significa que si miramos a todas las personas obesas, y las comparamos con las más delgadas, veamos este gen únicamente en las personas obesas, eso es falso. Si se hiciera eso, la conclusión sería que factores como la comida basura y el sedentarismo, tal vez los azúcares simples, están detrás de la obesidad. No habría correlación tan precisa entre gen y obesidad.

2) Mutar a unos animales para privarles de la actividad de un gen, y ver que son más delgados, no significa que tener la actividad del gen sea la que te haga obeso, como el hecho de tener manos no implica que las vayas a usar para apuñalar. Sin embargo, si se observa el nivel de apuñalamientos entre personas mancas y personas con manos, se verá un nivel superior en aquellas personas con manos. Realmente es lo mismo a escala molecular: es verdad que sin ese gen no podrías acumular la grasa, pero la presencia de una variante concreta del gen no te va a convertir en obeso, ¡eso dependerá del modo en que te alimentes, tu estilo de vida y tu estado de ánimos incluso!.

[IMG]https://i1.wp.com/i62.tinypic.com/wch5b4.jpg[/IMG]

Os muestro estudios con genes vinculados a otras cuestiones y donde se sacan conclusiones similares. En cuanto pueda haré unos comentarios sobre estos artículos.

http://www.abc.es/salud/noticias/20140313/abci-sueno-201403131319.html

http://www.pnas.org/content/106/7/2118.long

Anuncios

marzo 22, 2014 - Posted by | Actualidad, Control de la sociedad, Salud humana y Nutrición, Transgénicos

5 comentarios »

  1. Reblogueó esto en yofumoenpipa.

    Comentario por LupeMateo | marzo 23, 2014 | Responder

  2. Cierto, hay casos reales de gente que ha pasado de obesidad a la anorexia y se han quedado como un esqueleto y a punto de morir de desnutrición .. así que la alimentación depende mucho..

    No hay que obsesionarse tampoco con adelgazar y comer poco , porque esto resulta fatal también, está claro que todos somos capaces de llegar a los dos extremos…

    Comentario por MAGI | marzo 23, 2014 | Responder

  3. Ahí lo tienes MAGI, por eso creo que se me entiende cuando digo que aunque está bien ver la participación de genes concretos en el metabolismo de la grasa (aquí, genes FTO y IRX3) pero no se puede hacer una equivalencia entre ‘mayor propensión a obesidad’ y ‘determinada variante del gen’ sin contar con los factores de alimentación y estilo de vida. Al desligar una cosa de la otra, es cuando se concluye que ‘se podrán hacer nuevos fármacos que por diana tengan la inactivación de ese gen’ una conclusión interesada especialmente para la industria farmaceútica. Este gen no es ‘la mitad de la historia’ en la obesidad, la totalidad de la misma la ocupa la alimentación y el vivir en grandes ciudades, puestos de trabajo inmovilizados, etc. Sin estos factores, el gen no tiene ninguna capacidad de inducir la obesidad.

    Comentario por paramisonenigmas | marzo 23, 2014 | Responder

  4. Interesante artículo, buen trabajo

    Comentario por Bloguero | marzo 24, 2014 | Responder

  5. Esta noticia confirma lo que dije en este artículo [ Un análisis más exhaustivo del genoma humano libera al gen AMY1 de ser uno de los mayores responsables de la obesidad ]:

    http://www.abc.es/salud/noticias/20150623/abci-obesidad-201506231136.html

    Comentario por paramisonenigmas | abril 2, 2016 | Responder


Responder

Introduce tus datos o haz clic en un icono para iniciar sesión:

Logo de WordPress.com

Estás comentando usando tu cuenta de WordPress.com. Cerrar sesión / Cambiar )

Imagen de Twitter

Estás comentando usando tu cuenta de Twitter. Cerrar sesión / Cambiar )

Foto de Facebook

Estás comentando usando tu cuenta de Facebook. Cerrar sesión / Cambiar )

Google+ photo

Estás comentando usando tu cuenta de Google+. Cerrar sesión / Cambiar )

Conectando a %s

Reflexiones Antropológicas

Pensamientos acerca del pasado y el ahora desde una perspectiva enfocada en el hombre y sus diversas manifestaciones.

Un rincón que te abrigue

Mis escritos, mis canciones, mi reflejo

El foco

Reseñas de cine

How to blue

Un blog acerca mi vida personal sientete libre de juzgar.

DERRIBANDO EL MURO

Rompiendo el Paradigma

Reparaciones profesionales 24 horas

Persianista-Fontanero-Cerrajero-Electricista

Wanderlust

Travel Blog

Yo Soy Tu Profe

Aprender ciencias es mucho más fácil de lo que te imaginas

literatoluisrodriguez

Literatura y consejos.

Geografía e Historia en la educación permanente

El profesor Luis Durán quiere acercarte al Ámbito de Sociedad en la educación de adultos.

mariacarmenossapena

Relato momentos que cualquier persona en un momentos determinados podemos sentir; como una ausencia, un duelo, momentos que para uno se hacen duros, pero al transcribirlos de papel a formato on line y dándole así vida, se puede hacer entender a alguién que los momentos de alegría y pena es un estado que como ser humano y ser individual; nos toca pasar. Situaciones que nos hacen crecer; hacía un enriquecimiento personal, humano y con el entorno, familia,amigos, parejas, experiencias que son necesarias tener para ir creciendo en nuestro interior.El día que escribí esto lo escribí de un tirón y no mire las normas de ortografía; simplemente me deje llevar y quedo así como en prosa, pero sin normas preestablecidas.Quiero decir que escribo como hobby, y si encuentran errores es porque soy nueva por aquí y poco a poco intentaré hacerlo mejor . Pd : y Gracias por leerlo y opinar también se puede acepto todo tipo de critica constructiva.Saludos a todos.

UNIVERSO PARALELOS

Historias, personajes únicos, relatos ficticios y un extraño hombre que nos alcanza semanalmente sus raras teorías.

" Una Voz en el Silencio "

Literatura, reflexiones, pensamientos, fotografía, arte, musica, cine y cosas de actualidad

A %d blogueros les gusta esto: