Para Mí Son Enigmas

Un debate es una lucha que fortalece a todos los que participan.

EL COMPOSTAJE.

Quiero hablaros sobre el compostaje y explicaros cómo se puede hacer. Me gustaría poder ofreceros imágenes o vídeos hechos por mí, mostrando cómo yo mismo he elaborado compost o abono orgánico aunque sea a una pequeña escala, pero no me ha sido posible hacerlo y sin embargo, creo urgente empezar esta nueva serie de artículos que hablarán de cómo alcanzar la autosuficiencia. A partir de ahora voy a centrar este blog mucho en este sentido. Volvernos autosuficientes es fundamental para obtener nuestra soberanía como seres humanos, y nuestra libertad. Además, es más que probable que sea cuestión de vida o muerte en un futuro cercano, en especial porque seguramente esta civilización está llegando a un límite, que sin duda no podrá sobrepasar y cuando eso ocurra, empezará a declinar y se derrumbará. Lo que pasará entonces es que los servicios empezarán a escasear y cuando eso afecte a los servicios básicos como electricidad o agua, la gente se quedará sin ellos. Las personas que no tengan un medio de vida autosuficiente, simplemente morirán por enfermedades, desnutrición, etc. No es posible saber cuándo pasará esto, pero veo como algo muy probable, y casi inevitable que ocurra.

Estaría muy bien que si sabéis algo sobre compostaje o lo practicáis pongáis toda la información posible o vuestra experiencia con imágenes, etc, para los que aún no sabemos.

El compostaje es una de las cosas más importantes ya que sabiendo hacerlo obtendremos nuestro fertilizante a partir de restos de materia orgánica (vegetal o animal).

hands-of-compost.jpg

En primer lugar, cuando uno hace agricultura (se entiende que orgánica), no hay que alimentar a las plantas en si, sino al suelo donde éstas crecerán. Se puede fertilizar con estiércol de animales, o con restos de hojas por ejemplo, echados en el suelo y enterrados, con el tiempo se digerirán. Pero esto tiene varios inconvenientes. Primero, el estiércol es frecuente que atraiga a las pulgas. En cuanto a restos de vegetación, pueden llevar plagas, ya sean bacterias, hongos, virus o huevos de insectos.

Todo esto se resuelve mediante el compostaje. Esto consiste en amontonar la materia orgánica de forma que con el tiempo se degrade con la acción de hongos, bacterias y lombrices. La mejor lombriz es sin duda la lombriz roja californiana, pero hay otras que pueden participar. Por eso se distingue entre el compost y el vermicompost (que es hecho con la lombriz roja específicamente). El compostaje convierte estos restos en un material muy rico en materia orgánica, pero a la vez más suelto, más estable, y más limpio que los restos de inicio. También de menor volumen.

Hay dos formas básicas de crear el compost. La más sencilla es simplemente amontonar la materia en un lugar, lo que se conoce como montón. La segunda es, fabricar arcones, que son recipientes construidos a base de madera curada, ladrillo o cemento, que pueden taparse, dentro de los cuales se elaborará el compost.

how-to-build-a-compost-bin.jpgcompost-en-pilas.jpg

En cualquier caso hay que tener siempre en cuenta una serie de variables. Las más importantes son la temperatura y la humedad, sin duda ninguna. Las bacterias y hongos son más activos a unos 60 grados C, y el proceso puede alcanzar los 80 grados C, lo cual se nota por la emisión de un humo blanco. La temperatura indica el grado de actividad. Si es alta, es que el compostaje está realizándose. Si es baja, hay falta de actividad. Esto último puede deberse tanto a una falta de aireación como a una falta o exceso de humedad. Para aportar oxígeno (ya que el compostaje es un proceso aerobio, debe tener siempre oxígeno o se pudrirá) se revuelve con una pala. La humedad se nota de la siguiente manera: si al cogerlo el compost rezuma agua, es que tiene un exceso de la misma, lo cual se puede resolver añadiéndole paja, serrín, u otro material seco. Si está muy seco, se notará que el material está fragmentado y emite polvo. Esto requiere de un riego. El compost debe regarse siempre que se voltee y siempre que se note falto de actividad.

FASES DEL COMPOSTAJE.png

El compostaje atraviesa una fase mesófila (hasta unos 45 grados C) luego la termófila, que es la más activa (hasta los 80 grados C) le sigue una etapa de estabilización donde se enfría, y termina con la fase de oreo o maduración. En realidad, cada vez que se voltea o airea, se produce un enfriamiento y luego vuelve a calentarse. Los 3 meses se considera el mínimo para obtener un compost, pero si uno quiere que sea realmente bueno, debe dejarlo 5 o 6 meses: así se producirán los ácidos húmicos, y unas sustancias antibióticas que lucharán contra las enfermedades de las plantas. De esto se encargan los actinomicetos y son los que dan el típico olor a suelo fresco.

Los materiales también son muy importantes. Un buen compost, según se estima, debe tener una determinada proporción entre carbono y nitrógeno. La relación óptima es de 30 a 35, es decir, de 30 a 35 veces más carbono que nitrógeno. Esto se consigue a ojo con la práctica, pero se puede analizar y calcular previamente con unas tablas que indican la proporción de C y N de los distintos materiales. Como ejemplo, la paja sería muy rica en carbono, y el estiércol muy rico en nitrógeno.

realacion-carbono-nitrogeno-tabla.jpg

diciembre 8, 2016 Posted by | Cambio climático / Ecología, Control de la sociedad, Salud humana y Nutrición, Transgénicos | 5 comentarios

LA SITUACIÓN DE LA AGRICULTURA (PARTE ii)

El modelo de agricultura intensiva se extendió a partir de los años 60 en lo que se llamó la “Revolución Verde” (a la expansión de los transgénicos hoy en día se le conoce como la “segunda revolución verde”). Hoy en día nadie puede dudar que se están presentando los problemas ambientales y sanitarios que ´comenté en la primera parte: agotamiento de los suelos, uso excesivo de fertilizantes y plaguicidas, gran facilidad para las plagas, y gran consumo de agua dulce en el riego de suelos pobres y explotados. En esta segunda parte os propongo las que creo que son las mejores alternativas para este tipo de agricultura, sin que eso vaya en perjuicio ni de la productividad ni del beneficio económico de los campesinos y agricultores (me temo que sí podría afectar a los beneficios de las multinacionales que producen los agroquímicos, y a quienes se lucran con la venta de plantas transgénicas).

EL POLICULTIVO.

policultivo

El policultivo era una medida de prevención contra las plagas muy utilizada a lo largo de la historia. El conocimiento de qué plagas afectan a un cultivo determinado es fundamental para establecer una estrategia de policultivo que sea eficaz. Incluso la combinación en un mismo terreno de variedades distintas de arroz ha demostrado que puede impedir la expansión de algunas plagas. Aparte de que un insecto o ácaro puede ver frenado su crecimiento al existir plantas que no puede usar como alimento, también puede ocurrir que una planta sea huésped de un enemigo natural (un depredador o un parasitoide) de una plaga que afecte a la otra planta del mismo terreno, lo que permite su control solo con el hecho de cultivarlas juntas. Si bien hay muchos insectos o ácaros fitófagos que son polífagos (comen muchos tipos de plantas distintas) esto también ocurre con muchos depredadores naturales: por ejemplo las mariquitas, crisopas, o chinches depredadoras.

El problema del monocultivo antes de la invención de los plaguicidas de síntesis por las empresas químicas, se puede ver en grandes epidemias como la que ocurrió en Irlanda a mediados del siglo XIX (1845-1846) y que mató a varios millones de seres humanos. Implicó la gran extensión de un hongo llamado roya o mildiu de la patata (Phytophtora infestans) especializado en solanáceas (patata o tomate entre otras). El hecho de que los irlandeses murieran de hambre significa que no podían cultivar en grandes cantidades otros cultivos que no fueran la patata o el tomate, afectados por el hongo. Esto fue debido a un bloqueo comercial que Inglaterra ejerció contra ellos. Sería esto solamente un ejemplo de cómo los monocultivos son el caldo perfecto para las plagas que arrasaron cultivos en el pasado.

MANTENER LA MICROFAUNA Y LOS COLOIDES DEL SUELO.

MICROFAUNA

Conocer la microfauna y saber cómo mantenerla activa contribuye a que el suelo mismo sea capaz de producir sus propios fertilizantes y de generar nutrientes a partir de los restos de las plantas que se cultiven y de los cadáveres o excrementos de estos animales. Por eso un suelo sin animales está muerto. Los animales, hongos y bacterias del suelo son responsables de la producción del humus, que es el coloide orgánico del suelo, mientras que la arcilla es el coloide inorgánico. Ambos contribuyen a la retención de agua y nutrientes, creando un suelo apto para el crecimiento de las plantas. Las micorrizas (simbiosis entre raíces de plantas y algunos hongos beneficiosos) es muy importante también fomentarla en las plantas que sean capaces de generarla, como muchas leguminosas. Entre los animales propios de la fauna del suelo están las lombrices, numerosos insectos como escarabajos, colémbolos, y gran cantidad de gusanos nematodos, muchos de ellos microscópicos. También hay ácaros de 8 patas que son beneficiosos, y algunos crustáceos terrestres como las cochinillas o “bichos bola”. Muchas plagas anidan, colocan sus huevos o atraviesan sus fases de larva en el suelo. ¡Imaginad la importancia de que existan en el suelo animales que compitan con ellas o las devoren como alimento, o que protejan a la planta del ataque a las raíces!

FAVORECER EL HÁBITAT DE ENEMIGOS NATURALES.

Aparte de incrementar la fauna en el suelo, se puede investigar a fondo el ciclo de vida de los animales beneficiosos porque devoran o parasitan a las plagas. Son muchos los ‘enemigos naturales’ de por poner un ejemplo los pulgones. Dos muy comunes son Myzus persicae y Aphis gossypii. Entre sus enemigos naturales hay avispillas parásitas (Aphidius colemanii, Aphidius ervi, Lysiphlebus testaceipes, Trioxis acalephae, Praon volucre, Ephedrus cerasicola…) y predadores como el mosquito Aphidoletes aphidimyza, mariquitas como Adalia bipunctata, Coccinella septempunctata o Hippodamia variegata, crisopas como Chrysoperla carnea, etc. Como ves, el hecho de estudiar y favorecer que estos animalillos se desarrollen, encuentren dónde vivir, encuentren las mejores plantas donde crecer, poner sus huevos o cobijarse, puede llegar a conseguir que ellos solos consigan impedir plagas. Ciertas arañas también cumplirían un papel, incluso ciertos pájaros que coman orugas. Al hecho de cultivar algunas plantas que no son para recoger sus productos sino solo para que se desarrollen estos animales beneficiosos se le llama ‘plantas búnker’.

agosto 31, 2016 Posted by | Biología, Cambio climático / Ecología, Cuidemos el planeta., Transgénicos | 4 comentarios

LA SITUACIÓN DE LA AGRICULTURA.

Hoy en día la mayor parte de la agricultura en el mundo es de producción intensiva, una manera de realizar los cultivos que disminuye la complejidad para crear un aumento en la cantidad de cosecha por unidad de área y de tiempo. La complejidad se hace bajar de dos maneras. La primera es que se cultiva una misma planta a lo largo y ancho de una gran superficie, y si se cultivan varias, deben estar separadas y aisladas. En segundo lugar, se simplifican los métodos de trabajo mediante máquinas, un enorme aporte de agua, y agroquímicos, que incluyen fertilizantes y productos fitosanitarios (herbicidas, insecticidas, acaricidas, fungicidas…). Como dato, más del 10% de la superficie de cultivos ya se dedica a los transgénicos, quienes siguen este modelo intensivo. Este modelo tiene éxito en producir suficientes alimentos para toda la humanidad (los motivos del hambre son distintos) pero tiene unas consecuencias muy negativas que están intentando ser corregidas con el regreso a métodos más “sostenibles” y “ecológicos” que también consisten en cultivos intensivos. De hecho, solo con métodos más blandos o más considerados con el entorno es que puede continuarse este modelo, que ya está llegando a su límite.

Entre las consecuencias negativas del modo de producción intensivo están:

AGOTAMIENTO DEL SUELO.

Para que las plantas puedan crecer y mantenerse sanas, necesitan un suelo rico en todos los nutrientes y que tenga una gran actividad biológica. Necesita multitud de animalillos como lombrices, escarabajos, insectos como los colémbolos, y abundante materia orgánica que alimente a esos animales, que a su vez la transformarán en nutrientes. El hecho de tener a un mismo cultivo durante todo o casi todo el año sin descanso, hace que el suelo se quede sin materia orgánica, sin agua y finalmente sin microfauna (ese conjunto de animalillos). Esto crea una dependencia extrema hacia los fertilizantes de nitrógeno, fósforo y cualquier otro mineral.

suelo agotado

GRAN ABUNDANCIA DE PLAGAS

Nada puede ser tan favorable para un insecto o un ácaro que le guste comer ciertas plantas como encontrarse con un campo donde no hay otra cosa. Solo el alimento que anda buscando. Así, un campo de maíz o de tomates, se convierte en un lugar perfecto para la expansión de orugas, hongos o moscas blancas, por poner solo algunos ejemplos. Ante la ausencia de mecanismos que les controlen o frenen su crecimiento como depredadores naturales o avispillas parásitas, estos insectos destrozarían toda la plantación si no fuera por la aplicación de productos tóxicos a lo largo de todo el cultivo con maquinaria especializada. Y es que todos estos insectos, hongos, ácaros y ‘malas hierbas’ que llaman plagas lo son solamente cuando crecen de manera ilimitada, y no cuando están en unas cantidades razonables, donde no pueden afectar a la productividad (de hecho a veces la aumentan).

plaguicida

EXCESIVO CONSUMO DE AGUA.

Un suelo que tenga carencia de coloides como el humus o la arcilla, apenas podrá retener el agua, que las plantas necesitan tener al alcance de sus raíces, no siempre muy profundas. Los suelos sin actividad biológica y a los que se suministran fertilizantes sintéticos, no tienen apenas humus. Esto hace que los materiales del suelo pierdan solidez y consistencia. Las lluvias, benéficas al principio, poco a poco van arrastrando el propio suelo hacia abajo, lo que se conoce como lixiviación. La capacidad de retener agua es muy pobre y estos terrenos acaban dependiendo de un aporte enorme de agua. Hoy en día, el 70% de toda el agua dulce se emplea en la agricultura, para que os hagáis una idea.

tecnificación-de-riego.jpg

DEPENDENCIA DE PRODUCTOS FITOSANITARIOS Y FERTILIZANTES DE MULTINACIONALES.

Dado que las condiciones son inmejorables para la expansión de los fitófagos (comedores de plantas) o de las enfermedades (hongos o virus) se hace oblgatorio utilizar estos productos de manera continua. Estos productos en muchos sitios están llegando a alcanzar niveles muy elevados en las corrientes de agua y los acuíferos. Se hace extremadamente necesaria su reducción en la medida que sea posible. Además, muchas plagas se hacen resistentes a ellos de forma natural.

Esto no se trata de alarmismo ni de una generalización, es lo que está ocurriendo en todo el planeta y se están estudiando maneras para corregir todo esto. Aparecen alternativas que en realidad tienen el objetivo de que la agricutura pueda seguir del mismo modo, entre ellas estas:

manejo-integrado-de-plagas-y-enfermedades-en-el-cultivo-de-tomate-1-638cbcontrolnatural

El manejo integrado y el control biológico se están aplicando e imponiendo legalmente por la urgente necesidad de reducir el uso de agroquímicos. Hace que las hortalizas sean más sanas al tener menos pesticidas. Generalmente se usa más en invernaderos que al aire libre. Pero hay que tener una cosa en cuenta: aunque es una mejoría por la reducción de la toxicidad del entorno, se trata de un negocio más, donde el agricultor sigue dependiendo de las industrias de elaboración de productos, que en este caso son depredadores naturales o parásitos. La agricultura es, igualmente intensiva.

Pero, ¿sería posible ir más allá?

agosto 29, 2016 Posted by | Actualidad, Biología, Cambio climático / Ecología, Cuidemos el planeta., Revolución / Capitalismo, Transgénicos | 2 comentarios

LA MODIFICACIÓN DEL ADN HUMANO, ¿UNA VENTAJA?

Hola, quiero hablaros de un tema que considero muy importante, porque estoy viendo varias noticias últimamente relacionadas con experimentos en los que se plantea alterar partes del ADN humano (el genoma) o en los que ya se ha hecho. Pienso que es bueno daros a conocer esto y transmitiros lo que pienso de este tema. Os recomiendo antes de todo que leáis las siguientes entradas anteriores del blog porque tienen muchísimo que ver con esto.

LAS MOLÉCULAS NO PIENSAN , ACERCA DEL GEN DE LA OBESIDAD

Durante mucho tiempo los genetistas han alterado el ADN de algunos seres vivos (animales, plantas, bacterias, o incluso virus) para ver qué consecuencias tenía y han asociado los cambios visibles o detectables químicamente (es decir, el fenotipo) con las secuencias concretas de ADN. En esta línea investiga Kari Stefansson en Islandia. Podéis leer aquí una noticia:

http://elpais.com/elpais/2015/03/25/ciencia/1427301768_778081.html

Stefansson es conocido por haber fundado una importante empresa llamada deCODE que se dedica a analizar y secuenciar genomas de seres humanos (normalmente tomando muestras de sangre) a lo largo del mundo e intentar localizar ‘factores de riesgo’ genéticos para enfermedades. Esta compañía quebró y fue comprada por Amgen, una gran multinacional biofarmaceútica estadounidense. En este estudio reciente, se ha secuenciado el genoma de 2636 personas de Islandia, y se ha llegado a una serie de conclusiones. Se puede leer en este enlace el estudio publicado en Nature:

http://www.nature.com/ng/journal/vaop/ncurrent/full/ng.3247.html

[IMG]https://i2.wp.com/i58.tinypic.com/2z8nj1l.jpg[/IMG]

Al poder ver la secuencia de los genes y otras zonas del ADN, el estudio ha hecho una serie de categorías. Algunas de estas ‘variantes genéticas’ o mutaciones del ADN son muy graves para la salud, otras son menos graves, otras son de escaso efecto y otras no afectan negativamente. De este modo, hasta un 8% de los islandeses tendría una grave mutación. Ejemplos de esas mutaciones serían cambios de una base de ADN (SNP, recuerda que una base es lo mismo que una letra de la cadena de ADN) inserciones (un trozo de más) deleciones (un trozo de menos) o intrones.

Estas conclusiones y formas de ver la relación entre el ADN y las enfermedades es un caso de ‘determinismo genético’ es decir, el asociar directamente un fragmento de ADN con una cualidad visible como una enfermedad. Por ejemplo, a las personas que tienen cierto tipo de gen MYL4 dicen que tendrán una enfermedad conocida como fibrilación atrial. Si tienes tal gen ABCB4, alto riesgo de enfermedades del hígado, o si tal variante de un gen distinto llamado GNAS, elevados niveles de TSH (hormona estimulante de tiroides).

Esta relación de causa y efecto, directa, no es verdadera. Cuando dicen que ‘tal variante de ADN está asociada a tal enfermedad’ eso no significa que la persona con la variante vaya a ponerse enferma, y tampoco significa que todas las personas enfermas tengan esas mismas variantes genéticas. Lo vimos claramente con el llamado ‘gen de la obesidad’ que en realidad no era tal cosa. El estudio es interesante, pero las conclusiones están basadas en el determinismo genético. Y es ese enfoque el que está llevando a que se plantee la posibilidad de modificar los genes humanos concretos para curar enfermedades.

No creáis que esto se ha hecho esperar mucho. EN la Universidad Sun Yat-sen de Guangzhou en China, unos científicos ya han utilizado un método molecular llamado ‘ Crispr – Cas9 ‘ para alterar ADN de embriones humanos, y tratar de erradicar una enfermedad llamada beta talasemia. Podéis verlo en esta noticia del ABC y en Nature:

http://www.abc.es/ciencia/20150425/abci-edicion-embriones-humanos-201504242050.html

http://www.nature.com/news/chinese-scientists-genetically-modify-human-embryos-1.17378

Pese al fracaso de ese método, son muchos y numerosos los biólogos y médicos que están ideando nuevos métodos para introducir cambios en el ADN humano que sean capaces de curar enfermedades. Pero no conviene olvidar que todos ellos lo hacen bajo la óptica de ese determinismo erróneo según el cual las variantes génicas son la causa directa de tales enfermedades. Os voy a poner otro ejemplo, el del investigador español Juan Carlos Izpisúa, reconocido en el campo de la biología del desarrollo embrionario humano.

http://www.elmundo.es/ciencia/2015/04/24/55398d3a268e3eb4388b4574.html

Como véis en ese artículo, ha trabajado en las enfermedades de las mitocondrias, y hecho una técnica que consiste en destruir ADN mitocondrial “enfermo” (como véis siempre el mismo prejuicio de que lo que está enfermo es el ADN en si). Se presentan estas ténicas como avances, pero lo cierto es que todas implican riesgos. El motivo es que en ellas subyace esa premisa determinista. Y también el simplismo de considerar un solo factor (la secuencia de bases del ADN) sin apenas considerar, o ver como algo sin mucha importancia, todo el cúmulo de factores que intervienen en las enfermedades a nivel molecular, celular y ambiental, como por ejemplo la expresión del ADN, la influencia de unas regiones del ADN sobre otros, la epigenética, y por supuesto la alimentación, el estilo de vida y la toxicología de las sustancias que nos envuelven, en la génesis de tales transtornos de la salud humana. Todos estos factores hacen una tarea peligrosa e insegura el intervenir mediante experimentos de laboratorio para intentar ‘mejorar’ a la especie humana, tal como pretende hacer la terapia génica, las vacunas de ADN, o la modificación de embriones.

Pregúntame todo lo que no entiendas, estoy abierto a debatir sobre este tema. Saludos!

[IMG]https://i1.wp.com/i59.tinypic.com/2mxg41k.jpg[/IMG]

abril 26, 2015 Posted by | Actualidad, Biología, Control de la sociedad, Misterios y enigmas., Transgénicos | 26 comentarios

¿ES EL ‘PIENSO’ PARA PERROS Y GATOS UNA ENORME ESTAFA?

Buenas, voy a tratar un tema que no he estudiado mucho, pero sí es conocido e igual vosotros me podéis aclarar unas cuantas cosas. Más bien soy yo el que pregunta, a diferencia de las otras entradas donde me suelo informar un poco.

Directo al grano: hay muchos veterinarios que recomiendan alimentar a perros o gatos ( por ejemplo, hay muchos más animales, pero estos son los que me tocan de cerca) con piensos industriales, prefabricados por lo que he podido leer en base a extractos de proteínas de carne, diferentes proteínas vegetales además, entre las que destacan el maíz y la soja (me apuesto lo que sea a que muchos de ellos transgénicos, importados de Estados Unidos o Argentina) y luego tiene toda una batería de vitaminas y minerales AGREGADOS es decir, que dado que la materia prima NO LOS CONTIENE estos pasan a ser aditivos de laboratorio. Sin contar con que las vitaminas sintéticas y las que se encuentran en la comida no son exactamente iguales, es evidente que muchos de estos piensos no pueden agregar TODO lo que necesita un animal, pues son quizás cientos de componentes. Estarán agregando lo que sea fundamental para la supervivencia, pero no todo.

Desconocemos también el origen de esas proteínas que forman la base del pienso. Lo que me han dicho es que es preferible escoger piensos que tengan menos proporción de agua, porque en relación al peso tienen más proteínas…

Bueno, y ahora mi experiencia. Yo he tenido a un perro casi un año dándole de comer carne y huesos, a un precio de cero euros, cero céntimos. Cuando le cambié la dieta a pienso, el perro estuvo 4 días enteros sin comer nada. Evidentemente, el hambre le FORZÓ a ingerir estas bolas de pienso que ni siquiera le parecían ser comida. Sé de muy buena tinta que cuando mi perro huele comida, repito: COMIDA (la que sea) no se lo piensa ni un segundo, especialmente si es algo animal. En cambio, este pienso solo se lo come por obligación y el plato dura horas lleno.

Otra experiencia la he hecho con gatos: les pongo un plato con su pienso, a continuación al lado les pongo otro con sardinas en lata. Os aseguro que ha sido inmediato el cambio a las sardinas.

Mi pregunta es, ¿qué les estamos dando de comer a estos animales y por qué los veterinarios anuncian que estos piensos son lo mejor? ¿Dónde están sus beneficios frente a la comida normal?

Si hablamos de precios, es evidente que la comida normal sale muchísimo más barata o si tenéis un poco de suerte, gratis.

[IMG]https://i1.wp.com/i62.tinypic.com/2h714d0.jpg[/IMG]

agosto 7, 2014 Posted by | Actualidad, Biología, Control de la sociedad, Salud humana y Nutrición, Transgénicos | 16 comentarios

OLIGOELEMENTOS, NO LOS OLVIDEMOS.

Hola, voy a seguir hablando sobre estos elementos minerales además de algunas vitaminas más, porque creo que si la gente tuviera más conocimiento de estos, sabrían la importancia en su salud, y como ya dije creo que la gente sabría cuidarse mucho mejor a si misma a través de los alimentos y en parte, depender menos de los médicos. Porque la falta de muchos de estos nutrientes está vinculada a graves y pequeñas enfermedades, o a veces solamente síntomas que se tienen y que no se sabe explicar. ¿Por qué me hormiguean las piernas o la espalda? Quizás, probablemente, sea por falta de vitamina B1. ¿Cómo puedo reducir mi fatiga mental? Una posibilidad, entre otras, es que falte vitamina B2. Y así muchas cosas. Aunque también hay síntomas psicosomáticos que dependen de mente y de las emociones, pero esto no significa que los nutrientes no influyan, es más, estoy seguro que hay dolencias que se afirman ser psicosomáticas solo porque no se sabe la causa real. Reivindico la medicina ortomolecular, aunque no tengo la experiencia de hablar con ninguno de los médicos en esta rama, porque es la que estudia este tipo de cosas.

Entradas antiguas relacionadas con este tema:

VITAMINAS Y ELEMENTOS QUE IGNORAMOS

ALIMENTACIÓN 5: LA MEDICINA ORTOMOLECULAR

Selenio

[IMG]https://i1.wp.com/i61.tinypic.com/vd0boj.jpg[/IMG]

¿Os preguntáis alguna vez si tomáis bastante selenio? Supongo que no, salvo que séais nutricionistas o gente interesada en la investigación en este campo, o personas que deben cuidar especialmente bien su salud. Pero, este mineral tiene una gran importancia. Voy a haceros una lista de todo lo que encuentre que este elemento puede conseguir:

  • Es necesario para que funcione toda una familia de enzimas llamadas ‘selenoproteínas’ como la glutatión peroxidasa o la tiorredoxina reductasa, quienes eliminan productos tóxicos del metabolismo que oxidan y dañan las células. Actúa entonces como un antioxidante. Esto sugiere que tomar suplementos de selenio puede ser positivo para numerosas enfermedades que tienen un componente inflamatorio: autoinmunes, Parkinson, infarto, epilepsia, etc.
  • Estas enzimas las utilizan los neutrófilos para matar patógenos, por lo que ayudaría a los neutrófilos a combatir infecciones. Varias funciones más del sistema inmune se ven disminuidas por la falta de selenio.
  • Es capaz de inducir la apoptosis (muerte celular) en células de cáncer de próstata, de una manera fulminante, sin afectar a las sanas.
  • Tiene un papel vital en el funcionamiento de la glándula tiroides: forma parte de 3 de las 4 formas de yodotironina desyodinasas. La falta de selenio se ha asociado a la destrucción y mal funcionamiento de la tiroides.
  • El selenio inhibe la enfermedad de Hashimoto, en la que la glándula tiroides es atacada por el propio cuerpo. Reduce los anticuerpos que atacan a la tiroides. También tiene un efecto positivo en la enfermedad de Graves.
  • La falta de selenio en la dieta del ganado industrial está vinculada a una alta cantidad de enfermedades que se producen en estos animales.
  • El selenio es capaz de eliminar del cuerpo el mercurio acumulado, un metal tóxico que todos albergamos en el cuerpo en cierta cantidad.
  • El selenio potencia el buen humor.

La deficiencia severa de selenio produce una falta de actividad de las enzimas que lo necesitan, y se ha observado en China la enfermedad de Keshan, por una región cuyos suelos carecen de selenio y las plantas no pueden incorporarlo. Es una enfermedad del corazón muy grave que afecta a mujeres y niños. Una deficiencia menos severa produce también defectos en el funcionamiento del páncreas, el hígado, etc.

Por otro lado, un exceso de selenio supone una enfermedad conocida como selenosis. Esta enfermedad se ha detectado también en una región de China en que los habitantes comían unos minerales de carbón con altísimo contenido en selenio (un mineral, por otro lado, escaso en las rocas terrestres). Al parecer induce pérdida del cabello, uñas y fallos neurológicos. Pero para alcanzar estos daños se necesita ingerir dosis muy elevadas del mineral a diario. Las organizaciones internacionales han establecido que la dosis máxima es de 400 microgramos cada día, por precaución. Desconozco si es posible llegar a intoxicarse de selenio a través de los alimentos, sí que se ha observado en mineros que han inhalado vapores de selenio, o en el caso de esa población china que ingería directamente minerales con un 9% de selenio. Este selenio se tiene que distinguir del selenio orgánico que llevan las proteínas o los aminoácidos, que es como viene en los alimentos y el único saludable.

Hay muchos estudios que alertan de la baja cantidad de selenio en la población europea, que al parecer, van bajando cada vez más los niveles en sangre. Esto se ha vinculado con la ausencia de selenio en muchos terrenos de cultivo sobreexplotados, debido a la agricultura intensiva.

Un dato adicional que creo que es importante, es que el selenio y la vitamina E (tocoferol) actúan juntos.

Y ahora, dónde encontrar selenio. Parece que el alimento con más selenio son las nueces del Brasil. Estas las produce un árbol sudamericano que no se cultiva, sino que es silvestre, y no está en una buena situación (calificada como vulnerable). Otros frutos secos, las semillas de calabaza o hinojo, diversas verduras (ajos, pepinos, hojas de ortiga…) los cereales integrales, las judías, la levadura de cerveza, el salvado de trigo, etc… Las carnes y los huevos también aportan buenas dosis de selenio. Por último, mencionar que el alga conocida como kelp, un alga gigante, es rica en selenio también.

Magnesio

[IMG]https://i2.wp.com/i60.tinypic.com/9tnwvo.jpg[/IMG]

Este mineral no puede ser más importante para el cuerpo humano, todas las células lo requieren en todo momento para numerosas actividades. Es por esto que hay que tomarlo en cantidades mucho mayores que el selenio, por ejemplo. Empiezo con su lista de beneficios y efectos:

  • Aunque no nos afecta como animales, el magnesio está incorporado en todas las moléculas de clorofila, por lo que está completamente vinculado a la fotosíntesis.
  • Más de 300 enzimas necesitan el magnesio para funcionar, y algunas de ellas son de primera importancia, como las que sintetizan el ATP (la moneda energética por excelencia de todos los seres vivos terrestres) o las que sintetizan el ADN y el ARN. Además, el magnesio es fundamental para mantener la estabilidad estructural del ADN. No sé si sabeis que el ADN tiene un esqueleto formado por fosfatos. Estos fosfatos necesitan interaccionar con el magnesio. Imaginad pues las cantidades requeridas del elemento para esto: enormes. El propio ATP suele estar unido al magnesio.
  • Es capaz de prevenir los accidentes cerebro-vasculares y los infartos de miocardio, causa número 1 de muerte en EEUU. Es más fácil morir de un infarto si se tienen bajos niveles de magnesio.
  • Innumerables estudios han demostrado la baja dosis de magnesio con un aumento de muertes súbitas.
  • En EEUU, bajos niveles de magnesio se asocian a diversas enfermedades como asma, diabetes y osteoporosis.
  • Ayuda a reducir la duración de las migrañas, y los síntomas de fibromialgia y síndrome premenstrual.
  • Se han observado bajos niveles de magnesio en más del 30% de alcohólicos y en un 85% de casos de delirium tremens.
  • Interviene en la generación de varios neurotransmisores, repolarización de neuronas [eficacia de la conducción nerviosa] la relajación muscular (destacando en el corazón, puesto que otro efecto de su falta son arritmias y vasoespasmo de la arteria coronaria)
  • Actúa como energizante y calmante.
  • El hidróxido de magnesio es un antiácido eficaz, y no es tóxico para la salud, a diferencia del hidróxido de aluminio que, por algún motivo que no entiendo, es uno de los más utilizados.
  • Está de sobra demostrada su capacidad laxante para las personas que tienen estreñimiento.
  • Forma parte de la estructura de todos los huesos, junto al calcio y el fósforo.
  • Mejora diversas funciones cerebrales: memoria, razonamiento, lucidez, etc.

Cuando una persona afronta condiciones prolongadas de estrés y fatiga, se produce unas bajadas de magnesio considerables.

Entre los alimentos más abundantes en magnesio, encontramos: el cacao, las almendras, las avellanas, pipas, nueces (frutos secos en general). Entre los vegetales destaca el germinado de diferentes plantas: arroz, trigo, mijo, entre otras muchas, por su alto contenido en clorofila. Legumbres como lentejas, alubias y garbanzos. La soja es un alimento con una gran cantidad (pero cuidado que no sea transgénica, recomendamos en este blog). El agua de mar contiene magnesio en un 3,70% de sus sales disueltas.

No os preocupéis por el exceso de magnesio, es muy difícil intoxicarse, ya que el sobrante se elimina a través de orina, heces, o sudor.

Zinc

[IMG]https://i2.wp.com/i61.tinypic.com/5dl5xw.jpg[/IMG]

Por si no fuera importante conocer los dos anteriores, este me parece especialmente importante conocerlo y hacer algo por adquirirlo en dosis suficiente. Al final veréis por qué.

  • El cinc es necesario para que funcionen más de 100 enzimas que intervienen en el metabolismo de proteínas, ADN y ARN.
  • Es fundamental para que funcione bien el sistema inmunitario (las defensas).
  • El zinc forma parte de la molécula de insulina.
  • Forma parte de todos los factores que influyen en el ADN, que se enganchan al ADN con una estructura llamada ‘dedos de Zinc’ que evidentemente, contienen zinc.
  • Es necesario para la acción de la superóxido dismutasa, es decir, actúa como un antioxidante fundamental.
  • Es fundamental para la próstata y el crecimiento de órganos reproductivos, y el semen es especialmente rico en zinc. Las células de Leydig (las que producen testosterona en hombres) ven favorecida esta síntesis por el zinc, ya que el zinc estimula la producción de ‘Hormona Luteinizante’ en el hipotálamo, que activa a las células de Leydig.
  • En el cerebro, es necesario para formarse las vesículas glutaminérgicas. Es vital para la plasticidad neuronal, y por tanto, para el aprendizaje.
  • Juega un papel esencial en la modulación de la acción de varios neurotransmisores, controlando la excitabilidad neuronal. De ahí que su déficit pueda causar depresión o Alzheimer.
  • El zinc favorece la rapidez en la cicatrización de heridas.
  • Participa en los sentidos del gusto y el olfato.

La deficiencia de zinc es mala para las defensas, puede provocar caída del cabello, impotencia sexual, diarrea, lesiones oculares y de piel, pérdida de peso, retardo en la cicatrización de heridas, anomalías en los sentidos del gusto y el olfato, etc. En períodos de rápido crecimiento, si hay deficiencia provoca serios efectos en el desarrollo mental, sexual y cerebral.

Parece que un alimento muy abundante en zinc es el germen de trigo. Las ostras destacan por su alto contenido. Pero también lo aportan cereales integrales, semillas de calabaza, las vísceras, las nueces, otro tipo de carnes y pescado, los garbanzos y otras legumbres, y la levadura de cerveza. 

Se han hecho estudios que han probado la ayuda de aportar suplementos de zinc en aquellas zonas donde la diarrea es una enfermedad frecuente, reduciendo la gravedad y duración. Como además la deficiencia de zinc disminuye la función del timo y los linfocitos T y B, hace más propenso a la diarrea, tuberculosis, malaria y enfermedades de la piel. Un déficit moderado, ya influye disminuyendo la actividad de linfocitos NK y la producción de InterLeukina 2.

La dosis recomendada de zinc en España, por los organismos internacionales, es de 15 miligramos al día, aumentando a 20 durante el embarazo y 25 durante la lactancia. Pero, se ha comprobado que dosis, solo alcanzables con suplementos, de 100 a 300 miligramos no son tóxicas. En tales casos de toxicidad, se ha observado bajada de los niveles de cobre, y otros problemas.

Los atletas y otros deportistas son más propensos a la deficiencia de zinc, por su movilización más rápida desde las vesículas que lo contienen.

Las personas que fuman también necesitan mayor cantidad de zinc debido a la cantidad de tóxicos que inducen desmineralización.

junio 18, 2014 Posted by | Biología, Salud humana y Nutrición, Transgénicos | 6 comentarios

TRANSGÉNICOS: MUY FRECUENTES EN ESPAÑA.

Abro este post para daros una serie de datos e informaciones que a lo mejor no sabéis, o no os habéis dado cuenta. Y quiero hablaros de transgénicos, de los que algunos incluido yo nos creíamos libres, que nunca habíamos comido ningún vegetal ni animal transgénico. Pero antes de que se me acuse de ser alarmista o de utilizar la palabras ‘transgénico’ como si fueran cápsulas de gusanos capaces de devorarnos por dentro, os diré que lo único que pretendo hacer es informar y daros una idea del alcance que tienen los transgénicos, así como de una serie de estudios científicos que, precisamente informándome hace un rato, van más allá de lo que yo hubiera sospechado. Pero bueno, no me adelanto.

Como ya os decía en esta otra entrada ALIMENTACIÓN 4: TRANSGÉNICOS que sinceramente os recomiendo emplear unos minutos en leerla, España es uno de los pocos países que permiten el cultivo de diferentes variedades de plantas transgénicas. Es el caso del maíz Mon810, al cual se le ha incorporado una serie de genes que expresan una toxina para un insecto, llamado el ‘taladro’ y que es capaz de destruir los insectos, pero no de afectar a los humanos ni a otros animales. España cada vez ocupa mayor terreno al cultivo de este maíz, como véis en esta noticia:

http://www.publico.es/actualidad/498389/el-cultivo-de-maiz-transgenico-en-espana-bate-records-en-2013

No es la única variedad de transgénico que en los campos españoles está siendo cultivada a gran escala. Recientemente se ha aprobado en contra de la mayoría de los eurodiputados, el cultivo de una nueva variedad de maíz transgénico llamada TC1507 siendo España uno de los países favorables.

http://www.elnuevodiario.com.ni/internacionales/310821-union-europea-autoriza-cultivo-de-maiz-transgenico-tc1507

También parece que se intenta aprobar el cultivo de trigo transgénico que en Gran Bretaña provocó una fuerte protesta social (ver dos enlaces abajo).

http://esmateria.com/2013/05/09/el-csic-pide-cultivar-trigo-transgenico-para-celiacos/

http://www.elmundo.es/elmundo/2012/05/27/ciencia/1338146096.html

El trigo transgénico no se cultiva a gran escala en casi ninguna parte, pero sí que se hacen estudios de campo, o se cultivan parcelas experimentales. No obstante, muchos de los transgénicos están siendo utilizados sin los estudios apropiados acerca de sus consecuencias en la salud humana, en el ecosistema o en su posible traspaso a otros lugares, expandiéndose y mezclándose con las variedades ‘tradicionales’. Pero todo esto yo ya era más o menos consciente, os quiero poner unos enlaces que sinceramente me han impactado:

Lo que afirma aquí Jack Hannemann, la segunda persona que habla en el video, es que ha encontrado secuencias de ADN entre el genoma del trigo transgénico y el genoma humano que encajan, pudiendo darse el caso de que al comernos ese trigo el ADN del mismo interaccione con nuestro genoma, silenciando algunas zonas. Bueno, yo no le hubiera dado crédito al 100% si no hubiera visto previamente este estudio:

http://www.ncbi.nlm.nih.gov/pubmed/15782906

Que se refiere a una variedad de maíz transgénico Bt176 que fue rechazada por la Unión Europea. En el estudio, alimentaron a un grupo de gallinas con una dieta que tenía un 60% de maíz normal y al otro grupo con un 60% de maíz Bt176. Entonces se buscó la presencia del ADN de ese maíz en los tejidos de los animales.

 ‘In all evaluated chicken tissues of muscle, liver, and spleen, the corn-chloroplast ivr gene fragment was amplified. It can be deduced from these findings and from other studies that the transfer of DNA fragments into the body is a normal process that takes place constantly. Nevertheless, no recombinant plant DNA fragments such as recombinant bla or cry1A(b) fragments could be found. Bt-gene specific constructs from the Bt corn were not detected in any of the poultry samples, neither in organs, meat, nor eggs.

En todos los tejidos de músculo, hígado y bazo de las gallinas evaluadas, el gen ivr del cloroplasto del maíz fue amplificado. Puede deducirse de estas conclusiones y de otros estudios que la transferencia de fragmentos de ADN en el cuerpo es un proceso normal que ocurre constantemente. Sin embargo, ningún fragmento de ADN recombinante de la planta como los fragmentos bla o cry1A(b) se hallaron. Las estructuras específicas de Bt del maíz Bt no se detectaron en ninguna de las muestras de pollo, ni en órgano, carne o huevos’.

Hasta ahora, ¡yo no sabía que era tan corriente que el ADN de nuestros alimentos entrara a formar parte o interactuase con nuestro genoma! Un caso que puede explicar perfectamente la transferencia genética horizontal en muchos animales, así como la influencia profunda de lo que comemos en nuestra epigenética y en enfermedades como el cáncer. Pero sin irme del tema, y sobre lo que decía Hannemann, es cierto que para que las moléculas interaccionen tienen que ser lo más parecidas posibles (en biología lo llaman ‘secuencias complementarias’).

Bueno, después de leer hasta aquí, quizás pensáis que los transgénicos aunque estén aprobados legalmente en nuestro país, en realidad no son tan abundantes, y que deben estar siempre marcados y bien vistosos. En realidad no es así.

Por ejemplo, en el supermercado he podido ver etiquetas en las cuales uno de los ingredientes era ‘almidón modificado de maíz’. Durante un tiempo me estuve preguntando qué sería eso, cómo estaría modificado ese almidón. Pero hay una solución más fácil: se trata de almidón de maíz modificado. Esto tiene mucho más sentido, y es más claro. (Esto no es exactamente cierto, por favor lee el comentario abajo).  Es posible que muchos productos que tienen maíz en nuestro país, sean de hecho del maíz transgénico, siendo el Mon810 la más abundante por el momento. Pero no solo eso, muchos animales se les alimenta con ese maíz, desconozco si esto se hace en nuestro país o no.

Otra vía por la que en nuestro mercado puede haber transgénicos es la de productos importados. Los laboratorios NaturTierra producen por ejemplo complementos hechos de soja transgénica, evidentemente importada. La Unión Europea permite importar numerosos productos que llevan o son transgénicos. De este modo, se ha podido comprobar la presencia de transgénicos en numerosas marcas alimentarias. Dado que al parecer, si están presentes en menos de un 1% ni siquiera deben ser incluidos entre los ingredientes, a veces resulta muy difícil saber si un producto los ha utilizado o no. Yo dejo aquí esta lista que ha redactado GreenPeace entre marcas que están libres con total seguridad, otras que no se sabe, y otras que seguramente sí lo tienen, o que seguro los tienen, que están en rojo:

http://www.greenpeace.org/espana/Global/espana/report/transgenicos/2014/gpe_20012014_guia_roja_verde.pdf

http://gmoguide.greenpeace.ca/shoppers_guide.pdf

Aquí os dejo la opinión sobre los alimentos TG de un importante biólogo dentro de la genética, de hecho ha escrito algunos de los libros más básicos para el estudio de la genética, la biología molecular, etc, y se estudia con ellos en la carrera de biología:

abril 13, 2014 Posted by | Actualidad, Biología, Cuidemos el planeta., Transgénicos | 8 comentarios

ACERCA DEL GEN DE LA OBESIDAD.

Si veis la TV o la prensa puede que estos últimos días os hayáis cruzado con la noticia de que se ha encontrado un gen responsable de la obesidad, que hace que unas personas engorden más que otras aunque coman lo mismo. Quiero hacer unas reflexiones sobre este estudio y enlazarlo con otros en los que también se vincula un gen a la violencia (gen MAOA) o a la propensión a dormir más o menos (gen ‘despertador’) etc.  Se trata de un estudio realizado entre la Universidad de Chicago (EEUU) y el Centro Andaluz en Biología del Desarrollo de Sevilla y publicado el 12 de marzo de 2014 en la famosa revista ‘Nature’ (lo podéis ver abajo, aunque solo la introducción del estudio).

http://www.nature.com/nature/journal/vaop/ncurrent/full/nature13138.html

http://www.lanacion.com.py/articulo/159412–identificaron-al-irx3-o-el-gen-principal-del-engorde-humano.html

Lo que estos científicos han descubierto concretamente son dos cosas:

– Primero, que aquellas personas con una variante específica del gen FTO tienen, como media, un peso superior. Esto lo podéis ver en esta parte del artículo en Wikipedia:

‘A study of 38,759 Europeans for variants of FTO identified an obesity risk allele. In particular, carriers of one copy of the allele weighed on average 1.2 kilograms (2.6 lb) more than people with no copies. Carriers of two copies (16% of the subjects) weighed 3 kilograms (6.6 lb) more and had a 1.67-fold higher rate of obesity than those with no copies. ‘

[Un estudio de 38.759 europeos sobre variantes del gen FTO identificó un alelo de riesgo para obesidad. En concreto, los que tienen una copia del alelo pesaban como media 1’2 Kilogramos más que aquellos que no tienen ninguna copia. Los que tienen dos copias (que eran el 16% de los sujetos) pesaban 3 Kilogramos más y tenían una tasa de obesidad 1’67 veces superior a aquellos con cero copias.]

Voy a intentar aclarar lo que significa eso.

– Variantes del gen FTO: Un gen es una secuencia de ADN ubicada en los cromosomas. Dentro de la población humana, un mismo gen puede tener variaciones de secuencia respecto a otras personas (esto se llama polimorfismo). El ADN está compuesto por cadenas de cuatro ‘nucleótidos’ que se identifican con estas letras: A, G, C y T. Así, forman largas cadenas o secuencias de estas ‘letras’, por ejemplo:

AGGTCCGATTTAGCTGGATCGGATCGGATGCTGAGTCGATCG…

Pero los ‘genes’ que son solo aquellas partes del ADN encargadas de guardar información para fabricar proteínas, están divididos en varias partes que se llaman ‘intrones’ y ‘exones’.

[IMG]https://i2.wp.com/i60.tinypic.com/2hf8i8g.png[/IMG]

Estas son partes que se pueden incorporar o no a las proteínas finales, y esto es importante para lo del gen de la obesidad, porque la variante del gen FTO que está ligada a obesidad es una que tiene 1 de las letras cambiadas en un intrón. Los intrones son secuencias intercaladas en los genes que solo se incorporan opcionalmente a las proteínas, en la imagen de arriba, bastante buena y simple, lo que se ve es cómo solamente los exones al final se cortan y vuelven a pegar en el ARN mensajero (que luego irá a fabricar una proteína). Los intrones se eliminan y no se usan, en este caso, para incorporarlos a la proteína.

FTO es el ADN que se utiliza para fabricar la proteína FTO. Explicar la función de esta enzima lo veo ya bastante complicado para lo que es esta entrada, pero bueno si queréis os lo explico en los comentarios. Hablemos del intrón relacionado con la obesidad, y esta es la segunda cosa que han descubierto los científicos de este estudio.

– Ese intrón del gen FTO, en realidad es una secuencia reguladora de OTRO gen diferente y muy alejado del gen FTO. Esta segundo gen se llama IRX3 (o iroquois 3). Resulta, que la variante del gen FTO ligada a obesidad, lo es porque hace que el gen IRX3 se exprese más. Según los investigadores, una mayor expresión de IRX3 hace que el cuerpo tienda a acumular más grasa y es un factor de riesgo para obesidad.

Tenemos pues dos genes, uno que influencia al otro desde la distancia.

Entonces, se puede sintetizar todo el descubrimiento científico en dos puntos:

1) Aquellas personas con una variante concreta del gen FTO pesan en promedio algo más que aquellas que no la tienen.

2) Los animales a los que se ha suprimido el gen IRX3 (ratones ‘knockout’ por ejemplo, o ratones con el gen silenciado por ARN de silenciamiento, todo esto hecho por los propios científicos en laboratorio) son más delgados a pesar de comer una dieta elevada en grasa.

La conclusión es que la propensión a engordar es mayor en unas personas que en otras según su genética. Y esto no está mal saberlo, pero para estos investigadores: ‘los genes controlados por IRX3 pueden ser dianas para nuevos fármacos que permitan reducir la obesidad’. Pero resulta que el gen IRX3 no está solamente ligado a la obesidad, sino que él mismo controla a muchos otros genes, implicados por ejemplo en el desarrollo, en el sistema nervioso, etc… Es lo que se llama un ‘gen homeótico’. Esto lo convierte en una diana más que peligrosa para fármacos que lo inactiven, podría tener serios efectos secundarios.

Además, decir y transmitir a la gente que se ha descubierto un gen que hace más fácil la obesidad y achacarle a ese gen la responsabilidad es caer en lo que se llama el ‘determinismo genético’. La manera de prevenir la obesidad no es inactivar un gen, sino decirle a la gente que no coma comida basura, que haga más ejercicio o vea menos la TV. La conclusión de que esto abre una vía para la creación de nuevos fármacos etc, es más que interesada, imaginemos que se crean estos fármacos, con graves efectos secundarios, y que la gente los toma para adelgazar. ¡Esto significa, adaptar químicamente a la gente a un estilo de vida insalubre, sedentario y de mala alimentación! ¿Tal vez estas sean las intenciones del NIH (Instituto Nacional de Salud) de Estados Unidos, que es quien ha financiado esta investigación?

Es interesada por lo siguiente:

1) El hecho de que las personas con un determinado gen pesen un poco más en promedio que las que no tienen esa variante del gen, no significa que si miramos a todas las personas obesas, y las comparamos con las más delgadas, veamos este gen únicamente en las personas obesas, eso es falso. Si se hiciera eso, la conclusión sería que factores como la comida basura y el sedentarismo, tal vez los azúcares simples, están detrás de la obesidad. No habría correlación tan precisa entre gen y obesidad.

2) Mutar a unos animales para privarles de la actividad de un gen, y ver que son más delgados, no significa que tener la actividad del gen sea la que te haga obeso, como el hecho de tener manos no implica que las vayas a usar para apuñalar. Sin embargo, si se observa el nivel de apuñalamientos entre personas mancas y personas con manos, se verá un nivel superior en aquellas personas con manos. Realmente es lo mismo a escala molecular: es verdad que sin ese gen no podrías acumular la grasa, pero la presencia de una variante concreta del gen no te va a convertir en obeso, ¡eso dependerá del modo en que te alimentes, tu estilo de vida y tu estado de ánimos incluso!.

[IMG]https://i1.wp.com/i62.tinypic.com/wch5b4.jpg[/IMG]

Os muestro estudios con genes vinculados a otras cuestiones y donde se sacan conclusiones similares. En cuanto pueda haré unos comentarios sobre estos artículos.

http://www.abc.es/salud/noticias/20140313/abci-sueno-201403131319.html

http://www.pnas.org/content/106/7/2118.long

marzo 22, 2014 Posted by | Actualidad, Control de la sociedad, Salud humana y Nutrición, Transgénicos | 5 comentarios

AGRICULTURA ORGÁNICA.

[IMG]https://i2.wp.com/i44.tinypic.com/90niad.jpg[/IMG]

En esta entrada busco tratar el tema de la agricultura orgánica, también conocida como biológica o ecológica (hay pocas diferencias entre estos términos, yo prefiero el de orgánico porque le veo más sentido). Apenas he leído un poco sobre el tema pero me interesa en cuanto es un tipo de agricultura en principio más accesible al que tiene menos recursos, y que es válida para una producción pequeña: a este respecto he leído un libro que te enseña realmente con gran detalle cómo organizar tu propio campo y cómo se trabaja y cultiva, de John Seymour, se titula “el Horticultor autosuficiente”. Podéis descargaros aquí el archivo [ http://agro.unc.edu.ar/~biblio/El%20horticultor%20autosuficiente.pdf ] pero también es interesante a gran escala. Para deciros en qué se diferencia este tipo de agricultura del que hoy se practica masivamente en el mundo, voy a tomar del libro del ‘Horticultor autosuficiente’ los 6 principios que debes tener en cuenta:

  • El horticultor debe trabajar con la naturaleza y no en contra de ella.
  • La naturaleza es diversa por tanto el horticultor debe practicar la diversidad.
  • Debe criar otras formas de vida [animal o vegetal] en medios lo más parecidos posible al que les sea natural.
  • Debe devolver al suelo tanto, o casi tanto como le ha quitado.
  • Debe alimentar al suelo y no a las plantas.
  • Debe estudiar la naturaleza como un todo y no como una parte aislada.

Está claro que existen muchísimos tipos de agricultura, son principios muy generales que dan lugar a muchísimas posibilidades. Lo que más conoce la gente sin embargo, también es muy importante, y es que debes fertilizar el suelo y combatir las plagas con sustancias orgánicas es decir, que existan en un medio natural y que no hayan sido fabricadas por el ser humano. Pero esto es tan sólo un ideal, vivimos en un mundo hiper-industrializado y no se descarta utilizar incluso residuos industriales o determinados productos químicos que de manera manual no se podrían obtener (por ejemplo, he visto un método de ahuyentar ciertas plagas que consiste en hervir colillas, debido a que la nicotina repele ciertos insectos). Pero al final, esta posibilidad de recurrir a productos sintéticos es descartada a no ser que sea imprescindible. Por ejemplo en vez de abonar el suelo con abonos químicos de nitrógeno, fósforo, etc, se utiliza estiércol de animales, o compost que es materia orgánica (hojas, restos de plantas o animales, incluso basura orgánica) sometida a degradación por medio de bacterias, lombrices, etc. Todo esto requiere tiempo y trabajo, pero reduce y con mucho el precio y la necesidad de dinero.

Podríamos pensar que la agricultura ha sido orgánica por fuerza durante milenios: antiguamente no había abonos de síntesis, no había maquinaria tan pesada, no había métodos de alterar y modificar hasta tal punto los ciclos vitales de las plantas. Respetar los ciclos naturales y las estaciones de cada lugar era una necesidad si se esperaba obtener cosecha. Abonar el suelo con humus, utilizar determinados cultivos como ‘abono verde’ [es decir: plantas que se dejan crecer en un campo para luego enterrarlas y que fertilicen el suelo y den nitrógeno, como el trébol o el centeno] y depender de los depredadores naturales de las plagas para combatirlas, era la garantía de una cosecha abundante. La tecnología ha permitido hoy que la agricultura dejase de funcionar así, a partir de la Revolución Verde especialmente, con la idea de incrementar la producción y solucionar el hambre (un objetivo claramente fracasado). Aquí podéis leer sobre la revolución verde: http://en.wikipedia.org/wiki/Green_Revolution

No se trata de volver al pasado al contrario, de hecho ahora hay métodos completamente innovadores. Entre ellos los más interesantes que he oído son la ‘permacultura’ y el método de ‘Masanobu Fukuoka’, un interesante autor del que quiero leer algún libro. Pero tampoco se trata solamente de una filosofía: la producción intensiva basada en grandes extensiones de monocultivos, el uso de fertilizantes y pesticidas generados en las fábricas, el uso exagerado de agua dulce [el 70% del agua dulce de todo el planeta se usa para regar cultivos] nos permite cultivar en suelos que sin ese aporte no podrían soportar tales plantas. De este modo, el suelo se vuelve infértil y estéril, se pierde la microfauna del suelo, y la dependencia de los productos químicos generados en biorreactores y en laboratorios es absoluta. Sin un uso constante y abundante de pesticidas, las plagas destruirían cualquier monocultivo intensivo hecho al modo moderno. Este modelo agrícola es el que obliga a la deforestación de amplias zonas de bosques primarios en el planeta. Pero la agricultura orgánica también sirve para producciones grandes. Para esto, en lugar de centrarse en un único cultivo todo el año, hace una producción más variable, más planificada.

Pero bueno, tampoco me quiero embrollar más en un tema del que apenas conozco, os dejo aquí ojalá os animéis a compartir lo que sabéis o a comentar lo que pensáis sobre esto!

Hay muchísimos documentales, libros, e información sobre este tema, os dejo con este video:

Os iré enviando las cosas que aprenda sobre el tema 😉

enero 20, 2014 Posted by | Biología, Cambio climático / Ecología, Cuidemos el planeta., Salud humana y Nutrición, Transgénicos | 11 comentarios

¿HAY SOBREPOBLACIÓN?

Hola, les dejo con una conversación en Twitter con Evolucionista, acerca de la sobrepoblación humana, espero que no te importe que ponga el debate directamente, pero es mucho más espontáneo que si preparo un nuevo post y así no hay que repetir nada. En esta conversación han salido temas bastante interesantes y variados así que les dejo con ella: lo que hay en naranja es de Evolucionista, lo que hay en verde son mis respuestas:

A continuación explico por qué a las élites les interesa la superpoblación mundial….

1) A los clérigos les interesa la superpoblación por que a mayor nº de personas, + pobreza, por tanto + creyentes de calidad

2) A mayor superpoblación ,menos recursos. Así la gente es +sumisa y colabora con la jerarquía pisando el cuello a sus semejantes

3) A mayor superpoblación, mayor cantidad de votos para las ratas políticas.

4) A mayor superpoblación , los salarios bajan y los esclavos producen más.

5) A mayor superpoblación, infinidad de “pequeños problemas sociales” con los que lidiar, haciendo + fuerte al sistema.

6) A mayor superpoblación, mayor número de ricos que explotan a un mayor número de pobres.

7) A mayor superpoblación,mayor cantidad de mano d obra disponible esclava. Tercermundializar el mundo,el sueño de las élites

8) A mayor superpoblación, mayores oportunidades de negocio.

9) A mayor superpoblación, mayor dificultad para organizar revoluciones.

10) A mayor superpoblación, mayor número de mestizajes interaciales, favoreciendo el Plan Kalergi sionista.

11) A mayor superpoblación, aumento de negocio de las armas, drogas, tabaco, alcohol y productos farmacéuticos.

12) A mayor superpoblación, aumento del negocio de la energía debido a la creciente demanda energética.

13) A mayor superpoblación, aumento del negocio de la prostitución, trata de blancas, robo y tráfico de órganos.

14) A mayor superpoblación, mayor número de subvenciones a empresas amigas para paliar los efectos del cambio climático.

En fin, podría seguir hasta mañana. Acabo con un par de vídeos: Terribles Consecuencias de la superpoblación http://www.youtube.com/watch?v=b4sMzGH4TBg

La democracia no puede sobrevivir a la superpoblación (Isaac Asimov)

¿Quien marca los limites poblacionales de una democracia?
El sentido común: las tribus de todos los continentes siempre controlaron su población teninedo más o menos hijos.
Yo he defendido que hoy hay mas del doble de alimentos para nutrir a tod@s y que es tema de mal reparto…
De hecho, los transgénicos vuelven a basarse en el tema de la “escasez”
La mayoría de la gente piensa que hay alimentos suficientes… en parte verdad… aún…
Pero los problemas más graves son el agua y la contaminación que 7.000 d habitantes generamos.Tierra no regenera tan rápido
Claro pero yo lo que pienso es que la solucion es cambiar el capitalismo y no reducir la poblacion…

Si no reducimos nuestra superpoblación mundial, crear un sistema de bienestar mundial disparará la superpoblación aún más.

Esto lo saben las élites y se hallan en una dicotomía mental de incertidumbre:

1)Si reducen la superpoblación, se les acaba el poder mundial y sus negocios macroeconómicos. 2) Si no hacen nada, también

Lo que probablemente van a hacer es reducir la superpoblación todo lo que puedan durante 20 años para sobreexprimir un poco más.

Pero sólo podrán sobreexprimir durante una o dos décadas más. “Luego ya veremos”. La hecatombe está cerca.

Darwin dijo que “las especies tienen a reproducirse siempre mucho más que los recursos disponibles”. Somos animales.

Sabes no creo que ese sea el comportamiento de la gran mayoria de especies, pero la nuestra es distinta, muy distinta.

La agricultura se inventó hace +10.000 años en sumeria extendiéndose hacia el Valle del Indo, Oriente Próximo y Europa…..

…debido a que no habían ya suficientes animales para cazar ni suficientes frutos y vegetales silvestres que recolectar..

Ya tenían superpoblación. Pero gracias a agricultura,en vez de aprender lección lo que hicimos fue reproducirnos como conejos

Y como ya habíamos talado demasiados bosques intentamos los cereales (alimentos para las aves) para alimentar humanos.

Pero como tampoco hemos aprendido la lección, inventamos las latas de conservas para seguir reproduciéndonos como conejos.

Y como seguimos sin aprender, ahora hemos inventado los transgénicos.

Y como parece ser que no vamos a aprender nunca, el próximo paso será el cierre de todos los restaurantes del mundo…

..y serán sustituidos por comercios d venta de “comida” para astronautas:cápsulas multivitamínicas y proteínicas concentradas

Estoy de acuerdo, pero podríamos vivir de otra manera, el sistema es quien nos utiliza y nos convierte en eso…
La destrucción de los bosques, la falta de agua, la desigualdad… ¿crees que se deben al sistema económico o a que somos much@s?
Nunca antes lo había visto desde ese punto de vista, y siempre me sorprendió por qué tan tardío el origen de agricultura…
Ahora ya lo sabes… Los humanos somos de naturaleza cazadora-recolectora. La agricultura es algo artificial.
Pero no por ser de tecnología es dañino ni va contra nuestra “naturaleza” ¡por algo vivimos mucho mas que el chimpancé por ejemplo!

Cada vez que se realiza un nuevo descubrimiento científico éste comienza a aplicarse para hacer el mal en mayor proporción que bien

Ejemplo: lo 1º que se hizo con descubrimiento de la energía nuclear fue bombardear Hiroshima y Nagasaki…

…Se tarda un tiempo antropológico para que la balanza entre el mal generado y el bien discriminado lleguen al equilibrio.

Sin embargo..hay muy buenas noticias..Si derrocamos el capitalismo ya no existirían problemas económicos para poblar el Sistema Solar

De hecho tenemos casi todo el Universo para reproducirnos, no sólo como conejos, sino como virus…

Por cierto, interesante este discurso del agente Smith a Morfeo en la película Matrix http://www.youtube.com/watch?v=NnURm5vO4Hk 

El agente Smith remarca lo peor de nuestra especie… se olvida de lo bueno que tenemos.

A veces pienso que la especie humana en vez de un avance evolutivo, es un tremendo retroceso.

Pero eso no se mantiene: la evolución humana ha traído muchísimas cosas buenas, oportunidades… que no se aprovechan, error.

Dos conejos en 1 hectárea pueden alimentarse. 20 conejos, también. 50 quizá sea el máximo…

..Si se siguen reproduciéndose cuando hayan comido el último gramo de hierba morirán todos porque no ha habido tiempo para crecer + hierba

Pero el ser humano es capaz de aprovechar muchas fuentes, y algunas serian ilimitadas si gestionase bien, la comida es una.

Y por supuesto, el agua es infinita en nuestro planeta: el espacio se puede gestionar mucho mejor obviamente, o habitar el mar

No podemos reproducirnos infinitamente en un espacio limitado. Si no lo entendemos estamos muertos.

A mi hija de 9 años le pregunté: ¿si mueren todos los conejos quién tuvo la culpa: el dueño del campo o los conejos?

Me contestó: “La culpa la tuvieron los conejos. Se matan ellos solos.”

Ahora yo pregunto a los adultos: Ahora que la gente está muriendo de hambre, ¿quién tiene la culpa?:…

¿La gente que no para de reproducirse como conejos o los capitalistas? Quienes tengan dudas que pregunten a los niños.

Bueno yo no estoy de acuerdo, pero me has hecho plantearme cosas como el origen de la agricultura.

Míralo con perspectiva global: imagínate que tú eres GEA (la Tierra). Cada vez hay más seres vivos comiendo y bebiendo de ti

Si hay demasiados comiendo, bebiendo de ti y contaminándote, te pones enfermo, cada vez más enfermo….

.. Al igual que cuando enfermas te dan antibióticos, GEA fabrica sus propios antibióticos. Uno de ellos se llama Capitalismo

Otro antibiótico se llama Guerra.Otro se llama Hambre. Otro se llama Sed.Otro se llama Destierro..alivian la enfermedad de GEA

Eso es demasiado simple (numérico) no valoras la capacidad de los seres para aprovechar lo que GEA dispone. GEA es infinita.

¿Justificas así el capitalismo? Ahora si que desenvaino…

No lo justifico. Da asco. Igual que dan asco las guerras y las injusticias. Simplemente explico lo que ocurre, aunque no guste
Pero dices que es por causa de sobrepoblacion… es debatible pero yo creo que otras son pues siempre hubo eso, con menos población
Sino existiera la superpoblación el NWO [New World Order] sería imposible. Se contaminaría menos, habrían +recursos disponibles y gente sería +buena
Eso quiere decir que esas cosas son NECESARIAS es totalmente absurdo eso…

No he dicho que sean necesarias. A un camión sobrecargado le pueden reventar las ruedas ¿Es necesario que le revienten las ruedas?

Simplemente le revientan. Pero algunos dicen que no es necesario aligerar la carga, que no hemos gestionado bien el llenado d ruedas

Pero la sobrecarga del camión se compensa si aumentas su capacidad. Nosotros disponemos de muchos mas recursos que otras especies.

Precisamente por nuestra inteligencia, disponemos de agua infinita, comida de sobra para miles de millones, espacio etc…

He estudiado a los neandertales. He aprendido mucho de ellos… Vivían en grupos de menos de 15 ó 20 a 5km de distancia…

Ellos ya calcularon el espacio de tierra que necesitaban para cazar, recolectar y tener agua suficiente….

No superaban generalmente los 20 individuos por cada 5km2. Aún así se las veían canutas para conseguir comida y agua.

En occidente superamos los 200hab/km2. Bajas a la calle y no ves un sólo ciervo para cazar, ni un río donde beber.

Nuestra alimentación depende exclusivamente de la industria y la agricultura intensiva. Somos sus esclavos.

En esto si que te doy la razón, estamos desligados al 100% de los recursos. Y eso no es bueno. Pero no es que no hayan.

Es una parte del modo de vida que llevamos, no de la cantidad de recursos que hay…

Son ambas cosas.
¿Los neandertales no aspiraban a desarrollarse tecnológicamente? De hecho copiaban al cromañón en lo que podían…
Sí aspiraban. Pero tuvieron 1problema: los Sapiens los invadimos al llegar desde Oriente Medio. Fueron desterrados y se extinguieron.

A ver ahora podemos pasar de hablar usando “tweets” a comentarios más largos y reflexivos sobre estos temas, os animo a participar y no se preocupen ya que esta conversación ya tuvo lugar en su día, pero pienso que era demasiado buena o interesante como para dejarla ahí. Mira, yo no estoy del todo de acuerdo con que la sobrepoblación sea el problema central de la especie humana, habría muchos más que resolver PERO sí es cierto que con nuestro modo de vida actual, ser tant@s se traduce en un enorme impacto destructivo sobre el medio ambiente, y nosotros mism@s. Además es verdad que nos ha llevado a una vida completamente artificial especialmente dentro de las grandes urbes. Creo que podríamos hacerlo mejor, pero desconozco si eso implicaría un número determinado de humanos. De hecho me parece que decir que el problema es que somos much@s no es más que una excusa barata para no cambiar. Pero, también da mucho que pensar el rumbo de nuestra sociedad…Un saludo!

Por otro lado en este blog he hablado de cómo estamos saqueando el mar y destruyendo los bosques, son los dos post más olvidados de este blog, ojalá tuviesen actividad ya que al menos para mí son muy importantes temas:

https://paramisonenigmas.wordpress.com/2012/10/02/saqueamos-el-mar/

https://paramisonenigmas.wordpress.com/2012/09/17/deforestacion/

Finalmente déjame poner una película que me parece realmente buena y que me ha recordado todo este tema: Instinto. Basta verla para entender muchísimas cosas.

octubre 18, 2013 Posted by | Actualidad, Cuidemos el planeta., Misterios y enigmas., Revolución / Capitalismo, Transgénicos | 12 comentarios

Reflexiones Antropológicas

Pensamientos acerca del pasado y el ahora desde una perspectiva enfocada en el hombre y sus diversas manifestaciones.

Un rincón que te abrigue

Mis escritos, mis canciones, mi reflejo

El foco

Reseñas de cine

How to blue

Un blog acerca mi vida personal sientete libre de juzgar.

DERRIBANDO EL MURO

Rompiendo el Paradigma

Reparaciones profesionales 24 horas

Persianista-Fontanero-Cerrajero-Electricista

Wanderlust

Travel Blog

Yo Soy Tu Profe

Aprender ciencias es mucho más fácil de lo que te imaginas

literatoluisrodriguez

Literatura y consejos.

Geografía e Historia en la educación permanente

El profesor Luis Durán quiere acercarte al Ámbito de Sociedad en la educación de adultos.

mariacarmenossapena

Relato momentos que cualquier persona en un momentos determinados podemos sentir; como una ausencia, un duelo, momentos que para uno se hacen duros, pero al transcribirlos de papel a formato on line y dándole así vida, se puede hacer entender a alguién que los momentos de alegría y pena es un estado que como ser humano y ser individual; nos toca pasar. Situaciones que nos hacen crecer; hacía un enriquecimiento personal, humano y con el entorno, familia,amigos, parejas, experiencias que son necesarias tener para ir creciendo en nuestro interior.El día que escribí esto lo escribí de un tirón y no mire las normas de ortografía; simplemente me deje llevar y quedo así como en prosa, pero sin normas preestablecidas.Quiero decir que escribo como hobby, y si encuentran errores es porque soy nueva por aquí y poco a poco intentaré hacerlo mejor . Pd : y Gracias por leerlo y opinar también se puede acepto todo tipo de critica constructiva.Saludos a todos.

UNIVERSO PARALELOS

Historias, personajes únicos, relatos ficticios y un extraño hombre que nos alcanza semanalmente sus raras teorías.

" Una Voz en el Silencio "

Literatura, reflexiones, pensamientos, fotografía, arte, musica, cine y cosas de actualidad